6 школа ирбит: Ирбитская специальная коррекционная общеобразовательная школа

Содержание

Муниципальные образовательные учреждения

Главная / Социальная сфера / Образование / Муниципальные образовательные учреждения

Перечень
общеобразовательных организаций, подведомственных
Управлению образованием Городского округа “город Ирбит” Свердловской области

 

Наименование ОУ

Сокращённое наименование

Адрес

Е-mail

Сайт

Телефон

ФИО руководителя

Муниципальное бюджетное общеобразовательное учреждение Городского округа “город Ирбит” Свердловской области “Средняя общеобразовательная школа № 1”

МБОУ «Школа № 1»

623850, г. Ирбит, ул. Свободы, д. 24

[email protected]

irbitschool1.my1.ru

+7 (34355) 6-38-54

+7 (34355) 6-38-57

Горбунов Роман Гаврилович

Муниципальное бюджетное общеобразовательное учреждение Городского округа “город Ирбит” Свердловской области “Основная общеобразовательная школа № 3”

МБОУ «Школа № 3»

623856, г. Ирбит, ул. Пролетарская, д. 46

[email protected]

irbit-3.uralschool.ru

+7 (34355) 6-73-05

+7 (34355) 6-43-22

Колпашникова Елена Александровна

Муниципальное бюджетное общеобразовательное учреждение Городского округа “город Ирбит” Свердловской области ” Основная общеобразовательная школа № 5″

МБОУ «Школа № 5»

623856, г. Ирбит, ул. Советская, д. 41

[email protected]

школа5.уорбит.рф

+7 (34355) 6-31-68

+7 (34355) 6-43-07

Адамбаева Людмила Анатольевна

Муниципальное автономное общеобразовательное учреждение Городского округа “город Ирбит” Свердловской области “Средняя общеобразовательная школа № 8”

МАОУ “Школа № 8”

623854, г.Ирбит, ул. Логинова, д. 14

[email protected]

8irbit.uralschool.ru

+7 (34355) 4-54-43

Воложанина Наталья Николаевна

Муниципальное автономное общеобразовательное учреждение Городского округа “город Ирбит” Свердловской области «Средняя общеобразовательная школа № 9»

МАОУ «Школа № 9»

623856, г. Ирбит, ул. Мальгина, д. 27

[email protected]

9irbit.uralschool.ru

+7 (34355) 6-41-92

+7 (34355) 6-41-93

Иванова Марина Валентиновна

Муниципальное автономное общеобразовательное учреждение Городского округа “город Ирбит” Свердловской области “Средняя общеобразовательная школа № 10”

МАОУ «Школа № 10»

623851, г. Ирбит, ул. Максима Горького, д. 3

[email protected]

irbit10.uralschool.ru

+7 (34355) 6-41-94

+7 (34355) 6-42-01

Ислентьева Елена Васильевна

Муниципальное автономное общеобразовательное учреждение Городского округа “город Ирбит” Свердловской области «Средняя общеобразовательная школа № 13»

МАОУ «Школа № 13»

623856, г.

Ирбит, ул. Мальгина, д. 53

[email protected]

irbit13.uralschool.ru

+7 (34355) 6-42-23

+7 (34355) 6-39-02

Ростовщикова Наталья Михайловна

Муниципальное автономное общеобразовательное учреждение Городского округа “город Ирбит” Свердловской области «Средняя общеобразовательная школа № 18»

МАОУ «Школа № 18»

623850, г.Ирбит, ул. Логинова, д. 22

[email protected]

18irbit.uralschool.ru

+7 (34355) 7-77-18

Фаттахутдинова Светлана Владимировна

 

Перечень
дошкольных образовательных организаций, подведомственных
Управлению образованием Городского округа “город Ирбит” Свердловской области

 

Наименование ОУ

Сокращённое наименование

Адрес

Е-mail

Сайт

Телефон

ФИО руководителя

Муниципальное бюджетное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 1”

МБДОУ «Детский сад № 1»

623850,

г. Ирбит

ул.Революции, 28

[email protected]

ds1irbit.ru

+7 (34355) 6-20-54

Боталова

Ирина Александровна

Муниципальное бюджетное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 2»

МБДОУ «Детский сад № 2»

623856,

г.Ирбит

ул.Елизарьевых, 33а

[email protected]

малышок.детсадирбит.рф

+7 (34355) 6-64-13

Долгополова Людмила

Геннадьевна

Муниципальное бюджетное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 5”

МБДОУ «Детский сад № 5»

623850,

г. Ирбит

ул. Орджоникидзе, 8

[email protected]

 

 

http://детсад5-ирбит.рф  

 

+7 (34355) 7-77-24

Ермакова

Елена Владимировна

Муниципальное автономное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад N 6”

МАДОУ «Детский сад № 6»

623850,

г.Ирбит

ул. 50 лет, Октября, 47

[email protected]

анютины-глазки. детсадирбит.рф

+7 (34355) 6-26-60

Левит

Алена

Валерьевна

Муниципальное бюджетное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области «Детский сад присмотра и оздоровления № 7»

МБДОУ «Детский сад № 7»

623856,

г.Ирбит

ул.Мальгина, 32а

[email protected]

родничок.детсадирбит.рф

+7 (34355) 6-45-46

Ловкова

Ольга Георгиевна

Муниципальное автономное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 9”

МАДОУ «Детский сад № 9»

623850,

г. Ирбит

ул.Советская, 97

[email protected]

тополёк.детсадирбит.рф

+7 (34355) 5-26-90

+7 (34355) 5-26-99

Подопригорова

Вера

Ивановна

Муниципальное бюджетное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 10”

МБДОУ «Детский сад № 10»

623850,

г.Ирбит

ул.Белинского, 2а

[email protected]

искорка. детсадирбит.рф

+7 (34355) 6-36-20

Молодых Татьяна Владимировна

Муниципальное бюджетное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 11”

МБДОУ «Детский сад № 11»

623850,

г.Ирбит

ул. Кирпичного

завода, 21

 

[email protected]

11i.tvoysadik.ru

+7 (34355) 6-22-76

Пшеницина

Елена

Николаевна

Муниципальное автономное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 13”

МАДОУ «Детский сад № 13»

623856,

г. Ирбит

ул.Азева, 26

 

[email protected]

хрустальный.детсадирбит.рф

+7 (34355) 6-29-61

Речкалова Марина Александровна

Муниципальное автономное дошкольное образовательное учреждение городского округа “город Ирбит” Свердловской области “Детский сад № 14”

МАДОУ «Детский сад № 14»

623850,

г.Ирбит

ул.Транспортная, 5

[email protected]

богатырь.детсадирбит.рф

+7 (34355) 6-25-77

+7 (34355) 4-26-21

Холкина

Елена Владимировна

Муниципальное бюджетное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 16”

МБДОУ «Детский сад № 16»

623850,

г. Ирбит

ул.Свердлова, 21а

[email protected]

колокольчик.детсадирбит.рф

+7 (34355) 7-77-98

+7 (34355) 7-77-93

Вискунова

Алена Николаевна

Муниципальное бюджетное дошкольное образовательное учреждение Муниципального образования город Ирбит “Детский сад № 19”

МБДОУ «Детский сад № 19»

623850,

г.Ирбит

ул.Логинова, 6.

[email protected]

irbitsad19.ru

+7 (34355) 7-77-56

Втехина

Инна Аркадьевна

Муниципальное бюджетное дошкольное образовательное учреждение Городского округа “город Ирбит “Свердловской области «Детский сад № 20»

МБДОУ «Детский сад № 20»

623850,

г. Ирбит

ул.Максима Горького,5а

[email protected]

20i.tvoysadik.ru

+7 (34355) 6-45-15

Вишнякова

Екатерина

Владимировна

Муниципальное автономное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 21”

МАДОУ «Детский сад № 21»

623856,

г.Ирбит

ул. Первомайская, 62а

[email protected]

https://ds21irbit.ru

+7 (34355) 6-37-20

+7 (34355) 6-49-41

Красулина

Наталья Владимировна

Муниципальное бюджетное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 22”

МБДОУ «Детский сад № 22»

623850,

г. Ирбит

ул.Максима Горького,8а

[email protected]

ягодка.детсадирбит.рф

+7 (34355) 6-22-18

Палкина Светлана Михайловна

Муниципальное автономное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 23”

МАДОУ «Детский сад № 23»

623850,

г.Ирбит

ул.Свердлова,15а

[email protected]

ds23.up6um.ru

+7 (34355) 7-77-96

Тищенко

Елена Николаевна

Муниципальное автономное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 25”

МАДОУ «Детский сад № 25»

623850,

г. Ирбит

ул.Елизарьевых,23а

[email protected]

25i.tvoysadik.ru

+7 (34355) 6-71-33

Сафронова

Ольга Валерьевна

Муниципальное автономное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 26”

МАДОУ «Детский сад № 26»

623850,

г.Ирбит

ул.Азева,23

[email protected]

сказка.детсадирбит.рф

+7 (34355) 6-31-16

(34355)6-40-37

Фоминцева Ирина Витальевна

Муниципальное автономное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 27”

МАДОУ «Детский сад № 27»

623850,

г. Ирбит

ул.Маршала Жукова,4а

[email protected]

ds27irbit.ru

+7 (34355) 6-09-68

+7 (34355) 4-26-11

Зенкова

Валентина Владимировна

Муниципальное автономное дошкольное образовательное учреждение Городского округа “город Ирбит” Свердловской области “Детский сад № 28”

МАДОУ «Детский сад № 28»

623850,

г.Ирбит

ул.Логинова,30а

[email protected]

sad-28.ru

+7 (34355) 6-41-91

Григорьева Ирина

Юрьевна

 

Перечень
образовательных организаций дополнительного образования, подведомственных
Управлению образованием Городского округа “город Ирбит” Свердловской области

 

Наименование  ОУ

Сокращённое наименование

Адрес

Е-mail

    Сайт

Телефон

ФИО руководителя

Муниципальное автономное образовательное учреждение дополнительного образования Городского округа “город Ирбит” Свердловской области “Центр детского творчества”

МАОУ ДО «Центр детского творчества»

623856,

г. Ирбит

ул. Пролетарская,

61

[email protected]

cdt-irbit.3dn.ru

+7 (34355) 6-48-66

Сухих Наталья Владимировна

Муниципальное автономное образовательное учреждение дополнительного образования Городского округа “город Ирбит” Свердловской области “Детско-юношеская спортивная школа”

МАОУ ДО «Ирбитская ДЮСШ»

623856,

г. Ирбит

ул. Ленина,12

[email protected]

дюсш-ирбит.рф

+7 (34355) 6-51-37

Шевчук Пётр  Николаевич

Муниципальное автономное образовательное учреждение дополнительного образования –Загородный оздоровительный лагерь Городского округа “город Ирбит” Свердловской области «Оздоровительно-образовательный центр «Салют»

МАОУ ДО ЗОЛ «ООЦ «Салют»

623850, г. Ирбит, ул. Советская, 100а

 

Ирбитский район, урочище «Белая горка»

[email protected]

irbitsalut.ru

+7 (34355) 5-25-48

+7 (34355) 5-18-90

+7 (34355) 5-17-99 

Бессонова Татьяна Геннадьевна

 

Сегодня 4 просмотра этой страницы

Школы — Справочник — Ирбит и Ирбитский район

Школа № 1

г. Ирбит, ул. Свободы, 24

+7 (34355) 6-38-54 , +7 (34355) 6-38-57

Школа № 1 (начальная школа)

г. Ирбит, ул. Красноармейская, 1

+7 (34355) 6-38-56

Школа № 10

г. Ирбит, ул. Максима Горького, 3

+7 (34355) 6-41-94 , +7 (34355) 6-42-01 , +7 (34355) 6-25-78

Школа № 13

г. Ирбит, ул. Мальгина, 53

+7 (34355) 6-42-23 , +7 (34355) 6-39-02 , +7 (34355) 6-42-15

Школа № 18

г. Ирбит, ул. Логинова, 22

+7 (34355) 4-25-61 , +7 (34355) 4-26-14

Школа № 3

г. Ирбит, ул. Пролетарская, 46

+7 (34355) 6-73-05 , +7 (34355) 6-43-22 , +7 (34355) 6-43-20

Школа № 5

г. Ирбит, ул. Советская, 41

+7 (34355) 6-43-07 , +7 (34355) 6-31-68 , +7 (34355) 6-56-97

Школа № 8

г. Ирбит, ул. Логинова, 14

+7 (34355) 4-25-04 , +7 (34355) 4-23-53

Школа № 9

г. Ирбит, ул. Мальгина, 27

+7 (34355) 6-41-92 , +7 (34355) 6-41-93

Вывод из запоя на дому

22.09.2022 – 00:13Разное1

Переедание характеризуется неконтролируемым приемом алкогольных напитков. Возникает на фоне развития абстинентного синдрома. Абстинентный синдром у людей с алкогольной зависимостью протекает значительно тяжелее, чем в общей популяции. Чтобы справиться с этими симптомами, алкоголики вынуждены постоянно увеличивать дозу алкоголя. Это принесло временное облегчение. Тошнота может быстро вернуться и вынудить вас принять еще… подробнее

Новые Газели NN

16.09.2022 – 23:43Разное25

В России люди уже давно отдают предпочтение универсальной и комфортабельной Газели. Преимущество этого автомобиля в том, что он выпускается в различных моделях для перевозки грузов или людей. Некоторые люди хотят знать, к какой категории относятся грузовые и пассажирские Газели и какая категория прав требуется для управления ими. Новые Газели NN – это последние модели от Горьковского автозавода. Однако дилеры по-прежнему… подробнее

Характеристики камер olympus

15.09.2022 – 16:16Разное14

Неоспоримым преимуществом системы Olympus является компактность камеры и объектива. Половина размера, вдвое больше веса. В сочетании с высокоточным объективом M.Zuiko и мощной системой стабилизации камера E-M1 Mark III позволяет делать четкие и четкие фотографии и видео в различных условиях. С OM-D E-M1 Mark III эти преимущества системы Olympus доступны для всех пользователей, которые ищут компактное и мощное… подробнее

Основные преимущества обращения в МФО

13. 09.2022 – 23:35Разное22

За несколько лет МФО доказали, что имеют право на определенную нишу в потребительском пространстве. Граждане все чаще пользуются услугами компании – количество заемщиков увеличивается с каждым годом, ведь займ срочно без отказа это весомое преимущество. Когда возникает необходимость в микрозаймах Иногда сложная финансовая ситуация может заставить вас пойти на риск и компромисс. Хотя доля МФО выше, чем доля банков,… подробнее

Инструментальная сталь, что это?

12.09.2022 – 23:12Разное39

Инструментальная сталь – это материал с содержанием углерода более 0,7%. Его ключевыми свойствами являются твердость и прочность, а их максимальные свойства достигаются при термообработке стали. Каталог иструментальных сталей достаточно широк, ведь в основном именно этот тип используется при изготовлении различных инструментов. Так называют стали, содержащие более 0,7% углерода. Основными его свойствами являются… подробнее

Датчики давления в шинах: их виды, установка, принцип работы

09. 09.2022 – 22:40Разное27

Разработку электронной системы, контролирующей давление в автомобильных покрышках, начали в 90-х годах в США. Необходимость такого нововведения была обусловлена стремлением повысить уровень безопасности транспортных средств. Сегодня для измерения давления в шинах применяются специальные датчики. Эти технические приспособления снимают, а затем преобразуют полученную информацию в формат электросигнала. Они являются важной… подробнее

Шоу резидентов Comedy Club

09.09.2022 – 22:15Разное31

«ХБ» — комедийное шоу, в котором Гарик Харламов и Тимур Батрутдинов играют самих себя, а не просто так. Название взято из двух заглавных букв фамилии актера. Проект несколько раз прерывался, но снова возвращался с обновлениями и улучшениями. Почти приличный юмор, большое количество образов, сыгранных всего двумя актерами, и уникальный формат – зарисовки реальных и вымышленных Гаррика Халамова и Тимура Бартрутдинова.… подробнее

Как работают проточные водонагреватели

09. 09.2022 – 22:08Разное17

Автономный источник горячей воды станет отличным решением для тех, у кого перебои с подачей, нет места для установки встроенной системы горячего водоснабжения и нет времени ждать отопления (дача, загородный дом). Поэтому часто выбирают проточные водонагреватели. Здесь https://sdmclimate.ru/vodonagrevateli вы можете выбрать подходящий именно вам водонагреватель. Как работают проточные водонагреватели Проточный… подробнее

Заправка картриджей с выездом мастера

04.09.2022 – 00:09Разное44

В настоящее время очень популярна заправка картриджей с выездом мастера. Это особенно полезно, когда человеку нужно очень срочно достать новые картриджи для принтера. Такой выезд на заправку — идеальное решение для тех, кто ценит личное время. В Екатеринбурге можно воспользоваться такой услугой в студии «Спектр». Преимущества заправки на выезде Если в офисе есть несколько принтеров, но нет запасных картриджей, нехватка… подробнее

Лучший вариант авиаперевозок

03. 09.2022 – 23:57Разное29

В последние годы наблюдается рост авиаперевозок. Их привлекает то, что у них есть возможность доставить груз вовремя, обеспечив максимальную сохранность товара. Тарифы на авиаперевозки могут сильно различаться. Все зависит от дальности доставки, специфики груза и его объема. Экономия в данном случае не оправдана. Приоритетом является работа с надежными и заслуживающими доверия поставщиками услуг. Транспортная компания… подробнее

Новости

Профилактика мошенничества.

12 сентября    |     Подробнее…


Полиция предупреждает об ответственности за экстремизм.

7 сентября    |     Подробнее…


С днём знаний!

6 сентября    |     Подробнее…


Диктант Победы

6 сентября    |     Фотоальбом    |     Подробнее. ..


Профилактика ДТП с участием лиц, использующих средства индивидуальной мобильности.

23 августа    |     Подробнее…


Опрос «Оценка реализации национального проекта «Образование» в Свердловской области в 2022 году»

17 августа    |     Подробнее…


Мошенники угрожают пенсионерам уголовным преследованием. Свердловская полиция советует не поддаваться на провокации

4 августа    |     Подробнее…


Медпомощь для жителей Свердловской области станет доступнее благодаря медчатам

2 августа    |     Подробнее…


Возник вопрос консультативного характера?

29 июля    |     Фотоальбом    |     Подробнее. ..


Полиция Ирбита предупреждает граждан о мошенниках, действующих по схеме «Ваш родственник попал в ДТП»

29 июля    |     Подробнее…


Предыдущие публикации: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11

Последние публикации

12 сентября

Профилактика мошенничества.

Новости

7 сентября

Полиция предупреждает об ответственности за экстремизм.

Новости

6 сентября

Диктант Победы

Новости

6 сентября

С днём знаний!

Новости

23 августа

Профилактика ДТП с участием лиц, использующих средства индивидуальной мобильности.

Новости

17 августа

Опрос «Оценка реализации национального проекта «Образование» в Свердловской области в 2022 году»

Новости

4 августа

Мошенники угрожают пенсионерам уголовным преследованием. Свердловская полиция советует не поддаваться на провокации

Новости

2 августа

Медпомощь для жителей Свердловской области станет доступнее благодаря медчатам

Новости

Обновления фотогалереи

Смотреть все фотографии

Знаменская средняя общеобразовательная школа в Ирбите, Свердлова, 6

Выберите регионМоскваСанкт-ПетербургАдыгеяАлтайский крайАмурская областьАрхангельская областьАстраханская областьБашкортостанБелгородская областьБрянская областьБурятияВладимирская областьВолгоградская областьВологодская областьВоронежская областьДагестанЕврейская АОЗабайкальский крайИвановская областьИнгушетияИркутская областьКабардино-БалкарияКалининградская областьКалмыкияКалужская областьКамчатский крайКарачаево-ЧеркесияКарелияКемеровская областьКировская областьКомиКостромская областьКраснодарский крайКрасноярский крайКрымКурганская областьКурская областьЛенинградская областьЛипецкая областьМагаданская областьМарий ЭлМордовияМосковская областьМурманская областьНенецкий АОНижегородская областьНовгородская областьНовосибирская областьОмская областьОренбургская областьОрловская областьПензенская областьПермский крайПриморский крайПсковская областьРеспублика АлтайРостовская областьРязанская областьСамарская областьСаратовская областьСаха (Якутия)Сахалинская областьСвердловская областьСеверная ОсетияСмоленская областьСтавропольский крайТамбовская областьТатарстанТверская областьТомская областьТульская областьТываТюменская областьУдмуртияУльяновская областьХабаровский крайХакасияХанты-Мансийский АОЧелябинская областьЧеченская республикаЧувашияЧукотский АОЯмало-Ненецкий АОЯрославская область

Екатеринбург – 128770Азанка – 0Алапаевск – 357Арамиль – 4037Артемовский – 215Арти – 21Асбест – 2303Атиг – 0Ачит – 20Байкалово – 10Баранчинский – 57Белоярский – 349Березовский – 7982Билимбай – 610Бисерть – 84Бобровский – 445Богданович – 338Большой Исток – 6061Буланаш – 32Бутка – 3Верхнее Дуброво – 1281Верх-Нейвинский – 294Верхние Серги – 24Верхний Тагил – 80Верхняя Пышма – 6817Верхняя Салда – 2649Верхняя Синячиха – 38Верхняя Тура – 49Верхотурье – 41Волчанск – 12Восточный – 3Гари – 3Горноуральский – 297Горный Щит – 4274Двуреченск – 156Дегтярск – 1273Дружинино – 49Еланский – 27Заводоуспенское – 6Зайково – 15Заречный – 1032Ивдель – 6Ирбит – 195Ис – 0Исеть – 182Исток – 50Калья – 0Каменск-Уральский – 11406Камышлов – 219Карпинск – 24Качканар – 329Кировград – 287Кольцово – 5989Красногвардейский – 9Краснотурьинск – 426Красноуральск – 195Красноуфимск – 94Кузино – 13Курьи – 16Кушва – 270Левиха – 6Лесной – 341Лобва – 3Луговской – 0Малышева – 21529Мартюш – 770Махнево – 3Михайловск – 144Монетный – 168Невьянск – 348Нижние Серги – 55Нижний Тагил – 26016Нижняя Салда – 104Нижняя Тура – 195Николо-Павловское – 354Новая Ляля – 26Новоуральск – 5423Новоуткинск – 58Пелым – 0Первоуральск – 9693Петрокаменское – 14Пионерский – 7Покровское – 12Полевской – 1988Привокзальный – 3Пышма – 37Ревда – 4489Реж – 2263Рефтинский – 234Рудничный – 0Садовый – 5667Свободный – 193Северка – 546Североуральск – 25Серов – 773Совхозный – 209Сосьва – 6Среднеуральск – 2141Староуткинск – 9Сухой Лог – 323Сысерть – 1020Тавда – 15Талица – 90Троицкий – 14Тугулым – 16Туринск – 31Туринская Слобода – 17Уфимский – 13Цементный – 34Черемухово – 0Черноисточинск – 293Шабры – 282Шаля – 64Шамары – 3Щелкун – 46Юшала – 3

⭐ Отзывы

Знаменская средняя общеобразовательная школа – адрес сайта

Знаменская средняя общеобразовательная школа в Ирбите, информация о сайте znamenschool. uoirbitmo.ru.

Знаменская средняя общеобразовательная школа по адресу Свердловская область, Ирбит, Свердлова, 6 в дальнейшем Организация, размещена в следующих категориях:

Для связи с организацией воспользуйтесь номером телефона: +7 (34355) 3-36-97.

Хотим обратить ваше внимание, на то, что у Организации есть сайт http://znamenschool.uoirbitmo.ru, поэтому для актуализации контактных данных советуем его посетить.

Если хотите посетить организацию, советуем вам заранее проложить маршрут. С помощью карты ниже, вы можете узнать точное расстояние, рекомендуемый маршрут, а также загруженность дорог в Ирбите.

Карта

Ориентировочное расстояние от центра города до организации 18.3 км.

Отзывы и обсуждение:

К сожалению, отзывов и комментариев нет. Поделитесь своим мнение, будьте первым =)

Как вы оцениваете организацию ?

Минимум символов: 0/50

Возможно вам будут интересны другие организации:

Адрес: Свердловская область, Ирбит, улица 60 лет Октября, 11
Режим работы:

Тел. : +7 (34355) 3-14-49
Адрес: Свердловская область, Ирбит, Школьная, 18
Режим работы:

Тел.: +7 (34355) 3-04-34
Адрес: Свердловская область, Ирбит, Школьная, 6
Режим работы:

Тел.: +7 (34355) 3-03-40
Адрес: Свердловская область, Ирбит, Толбузина, 16
Режим работы:

Тел.: +7 (34355) 3-01-26
Адрес: Свердловская область, Ирбит, улица Урицкого, 5
Режим работы:

Тел.: +7 (34355) 4-40-29
Адрес: Свердловская область, Ирбит, Центральная, 56
Режим работы:

22.09.2022 18:55

Общеобразовательные школы в Ирбите

Справочник Ирбит

Добавить

4 758 организаций

  • В ирбите мы нашли для Вас 64 общеобразовательных школы;
  • актуальные адреса и телефоны организаций Ирбита, схемы проезда, рейтинги и фото;
  • мы собрали для Вас 2 отзыва об общеобразовательных школах.

Гимназии

Детские сады

Колледжи

Лицеи

Техникумы

Дополнительное образование

Школы-интернаты

Частные школы

Учебные центры

Автошколы

Показать карту

Часы работы
пн-пт 08:00–17:00
Сайт
Телефон
+7 (34355) 4-42-43
Часы работы
пн-пт 09:00–17:00, перерыв 12:00–13:00
Сайт
Телефон
+7 (34373) 4-32-73, +7 (34373) 4-36-31
Часы работы
пн-сб 08:00–19:00
Сайт
Телефон
+7 (34355) 6-38-54, +7 (34355) 6-38-57
Часы работы
пн-пт 08:30–14:30
Сайт
Телефон
+7 (34355) 6-41-92, +7 (34355) 6-41-93, +7 (34355) 6-29-29
Часы работы
ежедневно, круглосуточно
Сайт

1 отзыв

Телефон
+7 (34375) 2-43-41, +7 (34375) 2-36-76, +7 (34375) 2-37-50
Часы работы
пн-сб 08:00–16:30
Сайт
Телефон
+7 (34355) 4-52-73, +7 (34355) 4-49-39
Сайт
Телефон
+7 (34355) 3-14-49, +7 (34355) 6-59-60
Часы работы
пн-пт 08:00–17:00
Сайт
Телефон
+7 (34355) 6-41-94, +7 (34355) 6-42-01, +7 (34355) 6-25-78
Часы работы
пн-пт 08:00–17:00
Телефон
+7 (34363) 2-67-73
Часы работы
пн-пт 08:00–18:00; сб 08:00–14:00
Сайт
Телефон
+7 (34355) 6-38-54, +7 (34355) 6-38-57, +7 (34355) 6-49-69
Часы работы
пн-пт 09:00–17:00, перерыв 12:00–13:00
Телефон
+7 (34355) 6-42-15, +7 (34355) 6-39-02
Сайт
Телефон
+7 (34355) 6-43-07, +7 (34355) 6-49-63
Часы работы
пн-пт 09:00–17:00, перерыв 12:00–13:00
Сайт
Телефон
+7 (34355) 6-35-28, +7 (34355) 6-35-88
Часы работы
пн-пт 8:00–17:00
Сайт
Телефон
+7 (34355) 6-43-07, +7 (34355) 6-49-63
Часы работы
пн-пт 09:00–17:00, перерыв 12:00–13:00
Сайт
Телефон
+7 (34355) 6-35-28
Часы работы
пн-пт 08:00–17:00, перерыв 12:00–13:00
Телефон
+7 (34355) 3-53-30
Телефон
+7 (34355) 5-17-32
Телефон
+7 (34355) 3-14-49
Телефон
+7 (34355) 3-06-97
Телефон
+7 (34355) 4-42-43
Телефон
+7 (34355) 6-28-48, +7 (34355) 3-66-69
Часы работы
пн-пт 8:00–17:00
Телефон
+7 (34355) 4-40-29
Телефон
+7 (34355) 6-73-05, +7 (34355) 6-43-22
Часы работы
пн-пт 08:00–17:00, перерыв 12:00–13:00
Телефон
+7 (34355) 5-13-20
Телефон
+7 (34355) 3-01-26
Телефон
+7 (34355) 3-35-50
Телефон
+7 (34355) 3-22-24
Телефон
+7 (34355) 3-41-68
Телефон
+7 (34362) 3-15-22
Телефон
+7 (34355) 5-15-30
Телефон
+7 (34355) 3-27-30
Телефон
+7 (34355) 3-22-37
Часы работы
пн-пт 09:00–18:00
Сайт
Телефон
+7 (34355) 3-33-63, +7 (34355) 4-41-72
Часы работы
Нет информации
Телефон
+7 (34362) 3-78-74
Часы работы
пн-пт 9:00–17:00, перерыв 12:00–13:00
Телефон
+7 (34355) 3-73-82, +7 (34355) 6-49-63, +7 (34355) 3-74-17
Часы работы
пн-пт 09:00-17:00, перерыв 12:00-13:00
Телефон
+7 (34355) 3-15-32
Телефон
+7 (34371) 2-26-30, +7 (34371) 2-19-58, +7 (34371) 2-11-78
Часы работы
пн-пт 08:00-17:00
Телефон
+7 (34355) 3-03-40
Телефон
+7 (34355) 3-54-97

1 отзыв

В Ирбите прошел Всероссийский день бега “Кросс нации 2018” — Ирбит и Ирбитский район

15 сентября 2018 года в Ирбите прошли массовые соревнования по легкой атлетике “Всероссийский день бега “Кросс нации-2018”

Фотографии в социальной сети Вконтакте

Фотографии в социальной сети Одноклассники

Победители и призеры соревнований

Дистанция 300 м

Воспитанники детских дошкольных образовательных учреждений

Мальчики 
1 место Михалев Арсений Детский сад №6 1. 07
2 место Юркин Иван Детский сад №5 1.08
3 место Курсов Александр Детский сад №26 1.11
4 место Махнев Макар Детский сад №26 1.12
5 место Носков Макар Детский сад №25 1.12
6 место Первушин Никита Детский сад №26 1.13

Девочки 
1 место Молокова Татьяна Детский сад №26 1.12
2 место Дмитриева Ульяна Детский сад №9 1.13
3 место Кармакулина Яна Детский сад №21 1.14
4 место Баканова Вероника Детский сад №21 1.15
5 место Речкалова Каролина Детский сад №9 1.16
6 место Силкина Тася Детский сад №10 1.17

Дистанция 500 м

1-2 классы общеобразовательных учреждений

Мальчики 
1 место Бессонов Артем Школа №10 1.55
2 место Нелюбов Тимофей Школа №18 1.58
3 место Дружинин Савелий Школа №8 1.59
4 место Лобанов Роман Школа №1 2.02
5 место Бобров Матвей Школа №10 2.04
6 место Покатило Тимур Школа №10 2. 06

Девочки 
1 место Середа Елизавета Школа №8 2.06
2 место Сёмкина Вероника Школа №1 2.10
3 место Щеломенцева Ксения Школа №8 2.11
4 место Новоселова Анастасия Школа №8 2.13
5 место Вятчина Василиса Школа №10 2.14
6 место Найденова Ангелина Школа №10 2.19

Дистанция 500 м

3-4 классы общеобразовательных учреждений

Мальчики 
1 место Касенов Тимур Школа №10 1.47
2 место Куткин Семен Школа №18 1.48
3 место Двоеглазов Артем Школа №8 1.49
4 место Боровиков Максим Школа №10 1.50
5 место Давыдов Александр Школа №10 1.52
6 место Григорьев Виталий Школа №10 1.53

Девочки 
1 место Шевелева Софья Школа №10 1.53
2 место Черепанова Алена Школа №13 1.57
3 место Гелашвили Елена Школа №10 2.00
4 место Шумкова Анна Школа №9 2.03
5 место Филинкова Надежда Школа №9 2. 04
6 место Зимина Карина Школа №9 2.05

Дистанция 1500 м

5-7 классы общеобразовательных учреждений

Мальчики 
1 место Бахтинов Максим Школа №8 5.46
2 место Кузьмичев Александр Школа №8 5.48
3 место Мозырев Данил Школа №8 5.51
4 место Неймышев Максим Школа №10 5.54
5 место Холкин Никита Школа №8 5.55
6 место Крылов Денис Школа №3 5.57

Девочки 
1 место Бунькова Валерия Школа №1 6.15
2 место Пелевина Лада Школа №8 6.37
3 место Иванова Анастасия Школа №9 6.39
4 место Лукиных Виктория Школа №8 6.45
5 место Радионова Анастасия Школа №8 6.47
6 место Клепикова Виктория Школа №13 6.49

Дистанция 1500 м

8-9 классы общеобразовательных учреждений

Юноши 
1 место Аксенов Вячеслав Школа №8 5.25
2 место Рожков Илья Школа №13 5.26
3 место Кудряшов Константин Школа №13 5. 27
4 место Казанцев Никита Школа №1 5.29
5 место Тимофеев Максим Школа №9 5.35
6 место Фадеев Иван Школа №8 5.37

Девушки 
1 место Сухарева Антонина Школа №1 6.10
2 место Глух Алина Школа №8 6.13
3 место Евтигина Мария Школа №9 6.29
4 место Крючкова Алина Школа №10 6.30
5 место Носова Кристина Школа №9 6.37
6 место Мочалова Полина Школа №18 6.38

Дистанция 1500 м

10-11 классы общеобразовательных учреждений

Юноши 
1 место Дружинин Данил Школа №18 5.00
2 место Котельников Сергей Школа №9 5.07
3 место Родионов Андрей Школа №8 5.09
4 место Кулов Егор Школа №9 5.11
5 место Зарецкий Кирилл Школа №13 5.15
6 место Суслов Михаил Школа №18 5.30

Девушки 
1 место Бурдукова Юлия Школа №13 6.03
2 место Кедрова Полина Школа №10 6.39
3 место Неустроева Наталия Школа №9 6. 44
4 место Конюшко Алена Школа №8 6.47
5 место Ждановав Елизавета Школа №8 6.56
6 место Мазуренко Александра Школа №8 7.01

Дистанция 1500 м

Средние специальные учебные заведения

Юноши 
1 место Туйков Максим УрГПУ 4.47
2 место Никитин Дмитрий Ирбитский гуманитарный колледж 5.19
3 место Родионов Иван Медколледж 5.25
4 место Изюров Сергей Ирбитский политехникум 5.26
5 место Подоксенов Владислав Ирбитский гуманитарный колледж 5.27
6 место Мизёв Владимир Ирбитский гуманитарный колледж 5.32

Девушки 
1 место Сидорова Светлана Медколледж 6.24
2 место Хекоян Нюш Ирбитский гуманитарный колледж 6.35
3 место Невская Милана Ирбитский гуманитарный колледж 6.38
4 место Алешкевич Виктория Ирбитский политехникум 6.48
5 место Толстых Анита Ирбитский мотоциклетный техникум 6.56
6 место Сафонова Кристина Ирбитский политехникум 7. 01

Дистанция 1500 м

Организации, учреждения и предприятия города

Мужчины 
1 место Жигалов Дмитрий г. Ирбит 5.05
2 место Дудырев Артем Школа №9 5.26
3 место Бушейко Дмитрий г. Ирбит 5.31
4 место Ильиных Денис Ирбитский мотоциклетный техникум 5.34
5 место Упоров Сергей Ирбитский молочный завод 5.38
6 место Годов Владимир Ирбитский молочный завод 5.49

Женщины 
1 место Мартынова Юлия Агрофирма «Ирбитская» 6.05
2 место Гурецкая Татьяна «Центр детского творчества» 6.41
3 место Чернозипунникова Анна «СИЗО-2» 7.10
4 место Кайгородова Екатерина Ирбитский молочный завод 7.25
5 место Алферова Анастасия Детский сад №5 7.33
6 место Мелентьева Ирина Детский сад №27 7.37

Как IRBIT, так и long-IRBIT связываются с обменником Cl-/HCO3- AE2 и координированно регулируют его активность посредством модулирования лизосомальной деградации AE2

Введение трифосфат) был идентифицирован как молекула, которая регулирует концентрацию Ca

2+ , конкурируя с IP 3 за рецептор IP 3 1,2 , и в настоящее время считается многофункциональным белком из-за его широкого спектра мишеней. молекулы 3 . ИРБИТ является фосфопротеином, и его фосфорилирование необходимо для связывания с некоторыми белками-мишенями 2,4 , а сам ИРБИТ взаимодействует с некоторыми протеин/липидкиназами и фосфатазами и участвует в модуляции сигналов фосфорилирования 3,5,6, 7,8 . Учитывая, что активность различных переносчиков ионов регулируется IRBIT зависимым от фосфорилирования образом, IRBIT может функционировать как сенсор, так и интегрирующий модулятор внутриклеточной ионной среды 9,10 .

Long-IRBIT (L-IRBIT) является гомологом IRBIT, и оба имеют высококонсервативный С-концевой домен S-аденозилгомоцистеингидролазы (AHCY) и N-концевые соседние сайты множественного фосфорилирования, но последний имеет отчетливо более длинный Удлинитель N-конца 11 . Предыдущие отчеты показали, что L-IRBIT обладает различной аффинностью связывания или функциональным действием на молекулы-мишени IRBIT 11,12,13 . Как IRBIT, так и L-IRBIT демонстрируют повсеместную экспрессию в тканях, но уровень экспрессии IRBIT обычно намного выше, чем у L-IRBIT. Однако на клеточном уровне L-IRBIT демонстрирует более ограниченный паттерн экспрессии, чем IRBIT, например, специфическая экспрессия в некоторых интернейронах мозжечка 11 . Недавний отчет о сплайсинге вариантов L-IRBIT с различными N-концевыми последовательностями показал, что каждый вариант обладает уникальными свойствами в отношении стабильности белка, спектра молекул-мишеней и функциональных последствий 14 . Вместе IRBIT и L-IRBIT могут образовывать гомо- или гетеромультимеры через консервативные домены AHCY. Предполагается, что «семейство IRBIT» служит узловым белком и участвует в различных клеточных функциях, особенно в регуляции внутриклеточной ионной среды 7,14 .

Внутриклеточный ионный гомеостаз имеет основополагающее значение для поддержания не только правильных биохимических реакций, но и нормальной морфологии и поведения клеток. В частности, регуляция клеточного объема представляет собой динамический процесс, который требует действия многих ионных каналов и транспортеров -15-. Например, при увеличении регуляторного объема (RVI), которое вызывается воздействием на клетки гипертонической среды, стимуляцией Na + /K + /2Cl котранспортеров (в основном NKCC1) или параллельной активацией Na + /H + анионообменники (в основном NHE, NHE1) и Cl /HCO 3 анионообменники (в основном AE, AE2) 15,16 . И NHE, и AE также являются основными регуляторами внутриклеточного pH, обычно выступая в качестве кислотных экструдеров и кислотных загрузчиков, соответственно 17 , и эти переносчики ионов способствуют поддержанию глобального внутриклеточного гомеостаза ионов и pH. Кроме того, поляризованная экспрессия этих транспортеров в клетке позволяет им функционировать локально и способствует миграции клеток, создавая локальные изменения объема клеток и/или внутриклеточные градиенты рН. Белки семейства IRBIT связываются с некоторыми из этих переносчиков ионов и регулируют их, участвуя в регуляции клеточного объема или миграции клеток; однако прямых доказательств их причастности пока не поступало.

В этом исследовании, чтобы изучить участие белков семейства IRBIT в таких клеточных функциях, мы попытались идентифицировать связывающие белки семейства IRBIT в клетках мышиной меланомы B16-F10, которые известны своей высокой метастатической природой 18 . Мы обнаружили, что как IRBIT, так и L-IRBIT связываются с продуктом гена SLC4A2, анионообменником 2 (AE2), через их консервативный домен AHCY. Мы создали клетки B16–F10 с двойным нокаутом IRBIT-, L-IRBIT- или IRBIT/L-IRBIT и исследовали активность AE2 и связанную с ней клеточную функцию в каждой мутантной клетке. Интересно, что активность AE2 была снижена только в клетках L-IRBIT KO, а RVI и клеточная миграция клеток L-IRBIT KO также были нарушены. Снижение активности АЕ2 в клетках L-IRBIT KO было обусловлено снижением уровня экспрессии белка АЕ2, который восстанавливался при обработке бафиломицином А1, специфическим ингибитором лизосомы Н9.0007 + -АТФаза. Экзогенная экспрессия IRBIT и/или L-IRBIT в клетках с двойным нокаутом IRBIT/L-IRBIT четко показала, что подавлению AE2 способствует гомомультимер IRBIT, который ингибируется коэкспрессией L-IRBIT. Эти результаты предполагают новый способ регуляции активности AE2, который был достигнут с помощью семейства IRBIT, основанный на модуляции стабильности его белков.

Результаты

AE2 – новая молекула-мишень белков семейства IRBIT

Мы попытались найти белки, связывающие семейство IRBIT, в клетках B16-F10, используя ко-иммунопреципитацию с антителами против IRBIT и L-IRBIT. Было обнаружено, что несколько белков специфически соосаждены с IRBIT или L-IRBIT (рис. 1A). Каждая полоса, указанная стрелкой или наконечниками стрелок на SDS-PAGE, была проанализирована с использованием анализа ЖХ-МС/МС, и идентифицированные белки перечислены в таблице 1. Среди них AE2, который был идентифицирован из сопреципитата ИРБИТ (рис. 1А, закрытая стрелка), хорошо известен своим участием в миграции клеток и регуляции объема клеток, и мы сосредоточились на его взаимодействии с семейством IRBIT.

Рисунок 1

Белки семейства IRBIT связываются с AE2. ( A ) Белки, связанные с IRBIT и L-IRBIT в клетках B16-BL6, полученные путем иммунопреципитации с использованием антител против IRBIT и против L-IRBIT, соответственно, визуализировали с использованием окрашивания серебром. Белковые полосы, указанные стрелками и стрелкой, были обработаны для анализа ЖХ-МС/МС. ( B ) IRBIT с маркировкой FLAG или L-IRBIT с маркировкой FLAG трансфицировали в Т-клетки HEK 293 отдельно или вместе с AE2 с меткой HA. Каждый лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с указанным антителом (IP). Ко-иммунопреципитаты анализировали с помощью иммуноблота с указанными антителами (ИБ).

Изображение полного размера

Таблица 1 Белок, связывающий семейство IRBIT, в клеточной линии мышиной меланомы B16F10.

Полноразмерная таблица

Во-первых, чтобы подтвердить связывание между белками семейства AE2 и IRBIT, был проведен коиммунопреципитационный анализ с использованием Т-клеток HEK 293, сверхэкспрессирующих белки семейства AE2 с меткой HA и белки семейства IRBIT с меткой FLAG. AE2 соосаждался либо с ИРБИТ, либо с L-ИРБИТ, и, наоборот, ИРБИТ и L-ИРБИТ соосаждались с AE2 в одинаковой степени (рис. 1B), что указывает на то, что AE2 является связывающей молекулой-мишенью как для ИРБИТ, так и для L -ИРБИТ.

Активность AE2 снижена в нокаутных клетках L-IRBIT

Чтобы понять влияние IRBIT или L-IRBIT на функцию AE2, мы установили нокаутные клетки семейства IRBIT с использованием системы CRISPR/Cas9. Мы подтвердили отсутствие IRBIT или L-IRBIT в двух независимо установленных клонах. Неожиданно уровень экспрессии AE2 изменился противоположным образом в каждой нокаутной клетке. То есть экспрессия AE2 была немного увеличена в нокаутных клетках IRBIT; с другой стороны, он был значительно снижен в нокаутных клетках L-IRBIT (рис. 2А). Затем мы измерили активность AE2 в каждой нокаутной клетке. Активность AE2 была представлена ​​внутриклеточным подщелачиванием при смене перфузионного раствора с Cl , содержащий один, на Cl , содержащий один. В контрольных клетках (дикого типа) с использованием этого протокола наблюдалось сильное подщелачивание, и подщелачивание было отменено в клетках с нокаутом AE2 (рис. S1A-C), что указывает на то, что подщелачивание в клетках B16-F10 было полностью получено из AE2. Активность AE2 в нокаутных клетках L-IRBIT была значительно снижена (рис. 2B). Мы заметили, что оба клона ИРБИТ КО продемонстрировали небольшое увеличение исходного pHi и активности AE2, однако разница не достигала статистической значимости (рис. 2C).

Рисунок 2

Активность AE2 снижается в нокаутных клетках L-IRBIT, и активность восстанавливается за счет экзогенной экспрессии L-IRBIT. ( A ) Клетки с нокаутом IRBIT или L-IRBIT (KO) были созданы с использованием стратегии CRISPR/Cas9, и два независимых клона каждой клеточной линии KO были проверены на экспрессию IRBIT, L-IRBIT и AE2 с использованием иммуноблота ( верхнюю панель). Показан относительный уровень экспрессии AE2 в каждой клетке KO по сравнению с контрольными клетками, N = 4 (нижняя панель). ( B ) Активность AE2 в клетках L-IRBIT KO исследовали путем измерения внутриклеточного изменения pH (ΔpHi) при замене перфузионного буфера с Cl , содержащего Cl , свободного буфера Рингера, содержащего рН-чувствительный краситель SNARF1. Репрезентативные графики изменения pHi, полученные для контроля (синий), L-IRBIT KO1 (красный) и L-IRBIT KO2 (оранжевый) (верхняя панель). Средняя активность AE2 (∆pHi/мин) каждого типа клеток составляла 0,21±0,02 (WT), 0,13±0,01 (L-IRBIT KO1) и 0,11±0,01 (L-IRBIT KO2), N = 3 (нижняя панель). . ( C ) Репрезентативный график изменения pHi, полученный для контроля (синий), ИРБИТ KO1 (красный) и ИРБИТ KO2 (оранжевый) (верхняя панель). Активность AE2 составила 0,22 ± 0,04 (WT), 0,25 ± 0,04 (ИРБИТ КО1) или 0,27 ± 0,01 (ИРБИТ КО2) соответственно, N = 4 (нижняя панель). ( D ) Влияние экзогенной экспрессии L-IRBIT на активность AE2 в каждом типе клеток, WT, L-IRBIT KO1, L-IRBIT KO2 или двойном нокауте L-IRBIT/AE2 (DKO). Клетки, экспрессирующие L-IRBIT, отбирали на основе коэкспрессируемых сигналов GFP. Синяя кривая представляет собой имитацию контроля, а красная кривая представляет собой L-IRBIT, экспрессирующие клетки WT B16–F10 (верхняя левая панель), клетки L-IRBIT KO1 (верхняя средняя панель), клетки L-IRBIT KO2 (верхняя правая панель) и клетки с двойным нокаутом L-IRBIT/AE2 (нижняя левая панель). ( E ) Средняя активность AE2 каждого типа клеток составила 0,15 ± 0,02 (WT + вектор), 0,20 ± 0,04 (WT + L-IRBIT), 0,10 ± 0,02 (L-IRBIT KO1 + 0-L-вектор), 0,25 ИРБИТ КО1 + Л-ИРБИТ), 0,07 ± 0,01 (Л-ИРБИТ КО2 + вектор), 0,21 ± 0,02 (Л-ИРБИТ КО2 + Л-ИРБИТ), 0,02 ± 0,01 (Л-ИРБИТ/AE2 ДКО ),+0,0вектор 0,01 (L-ИРБИТ/AE2 ДКО + L-ИРБИТ), N = 4.Общее количество клеток указано на каждом графике. * P  < 0,05, ** P  < 0,01, *** P  < 0,001, NS (не значимо).

Изображение в полный размер

Чтобы подтвердить влияние L-IRBIT KO на активность AE2, мы проверили, сохраняется ли активность AE2, когда L-IRBIT экзогенно экспрессируется в клетках L-IRBIT KO. Если L-IRBIT экзогенно экспрессировался в каждом клеточном клоне L-IRBIT KO, активность AE2 значительно увеличивалась в обоих клонах L-IRBIT KO. Кроме того, когда L-IRBIT был сверхэкспрессирован в контрольных клетках, активность AE2 слегка увеличивалась, и ни сверхэкспрессия, ни нокаут L-IRBIT не приводили к изменениям в клетках AE2 KO (рис. 2D и S1A-C). Эти результаты ясно показали, что потеря L-IRBIT в клетках B16–F10 снижала экспрессию AE2, что приводило к снижению активности AE2.

Связанные с AE2 клеточные процессы нарушаются в клетках, нокаутированных по L-IRBIT

AE2 участвует в восстановлении объема клеток после гиперосмотической стимуляции путем поглощения Cl клетками 19 . Чтобы оценить вклад L-IRBIT в регуляцию объема клеток путем регулирования активности AE2, мы исследовали восстановление объема клеток после гиперосмотической стимуляции с использованием метода тушения кальцеином 20 . Восстановление объема клеток наблюдалось после изменения осмолярности перфузионных буферов с 300 до 450 мОсм в контрольных клетках; однако он был почти устранен в клетках AE2 KO (рис. S1D), что указывает на то, что восстановление объема клеток, наблюдаемое в этих экспериментальных условиях, было связано с активностью AE2 (рис. S1E). В нокаутных клетках IRBIT скорость восстановления существенно не отличалась от таковой в контрольных клетках (рис. 3А). С другой стороны, нокаутные клетки L-IRBIT показали значительно сниженное восстановление объема клеток (рис. 3B). Эти результаты позволяют предположить, что L-IRBIT может участвовать в регуляции объема клеток посредством модуляции активности AE2.

Рисунок 3

Восстановление объема клеток после гипертонического стресса нарушено в нокаутных клетках L-IRBIT. ( A ) Восстановление объема клеток в клетках IRBIT KO измеряли на основе изменения флуоресценции при замене перфузионного буфера с буфера 300 мОсм на буфер 450 мОсм с использованием кальцеина-AM. Репрезентативные графики относительного изменения объема клеток по сравнению с исходным уровнем, полученным для контроля (синий), IRBIT KO1 (красный) и IRBIT KO2 (оранжевый) (левая панель). Эффективность RVI каждого типа клеток через 20 минут после замены буфера буфером 450 мОсм. Эффективность РВИ (%) составила 34,6 ± 13,6 (WT), 46,7 ± 5,6 (ИРБИТ КО1), 30,0 ± 7,7 (ИРБИТ КО2), N = 3–4 (правая панель). ( B ) Восстановление объема клеток L-IRBIT KO измеряли, как описано выше. Репрезентативный график относительного объема клеток для контроля (синий), L-IRBIT KO1 (красный) и L-IRBIT KO2 (оранжевый) (левая панель). Эффективность RVI каждого типа клеток составила 41,8 ± 6,1 (WT), 9,7 ± 5,6 (L-IRBIT KO1), 13,3 ± 5,0 (L-IRBIT KO2). N = 3—4 (правая панель). ( C ) Были показаны результаты анализа заживления ран. Показаны репрезентативные микрофотографии монослоя раненых клеток (левая панель). Ширина раны измерялась в 6 позициях сразу после ранения и через 18 ч у WT, ИРБИТ КО (ИРБИТ КО1, ИРБИТ КО2) и L-ИРБИТ КО (L-ИРБИТ КО1, L-ИРБИТ КО2), N = 4 (правая панель) . Общее количество клеток указано на каждом графике. * P  < 0,05, ** P  < 0,01, NS (не имеет значения).

Изображение полного размера

AE2 локализуется на переднем крае мигрирующих фибробластов, и его активность также необходима для миграции клеток 21,22 . Таким образом, мы также исследовали миграцию каждой клетки KO с помощью анализа царапин. Анализ проводили в условиях среды с пониженным содержанием сыворотки (0,5%), при которой не наблюдалось существенной разницы в скорости пролиферации среди клеток KO (рис. S2A и B). Клетки AE2 KO показали сниженную миграцию по сравнению с контрольными клетками, что указывает на то, что AE2 участвует в миграции этих клеток меланомы (рис. S2C, D). Миграция клеток L-IRBIT KO (L-IRBIT KO1 и L-IRBIT KO2) была значительно снижена (рис. 3C), а двойной нокаут AE2 и L-IRBIT не оказал никакого влияния на миграцию клеток, что позволяет предположить, что эффект Делеция L-IRBIT при миграции клеток была опосредована AE2. Напротив, клетки IRBIT KO показали аналогичную скорость миграции клеток по сравнению с контрольными клетками (рис. 3C).

В совокупности клетки L-IRBIT KO показали снижение экспрессии AE2 и снижение связанных с ним клеточных функций, что указывает на специфическую потенциальную роль L-IRBIT в модулировании активности AE2.

L-IRBIT связывается с AE2 посредством прямого взаимодействия общего домена AHCY семейства IRBIT и N-концевой области AE2

Хорошо известно, что IRBIT связывается и активирует NBCe1B, продукт гена SLC4A4. В этом случае IRBIT напрямую связывается со специфичной для сплайсинга N-концевой цитоплазматической областью NBCe1B 9.0007 4 . AE2 также относится к семейству генов SLC4A (также обозначаемому как SLC4A2) и имеет сходные структурные особенности с NBCe1B 23,24 . Таким образом, мы предсказали, что область, с которой связывается L-IRBIT, будет находиться в пределах длинной цитоплазматической N-концевой области AE2, и мы провели ко-иммунопреципитационный анализ связывания с использованием серии мутантов с N-концевой делецией AE2 (рис. 4A). ). Как показано на рис. 4B, при делеции N-концевой области в диапазоне от 76–524 а.о. L-IRBIT больше не связывается с удаленной формой AE2. L-IRBIT также не связывался с мутантами AE2, лишенными последовательности 76–347 а.о. Мутант AE2, лишенный аа 19Последовательность 9–524 связывалась с L-IRBIT в той же степени, что и AE2 дикого типа, что позволяет предположить, что сайт связывания находился в пределах 76–199 а.о. Однако мутант AE2, лишенный последовательности аминокислот 76–198, все еще связывался с L-IRBIT, но эта сила связывания была ниже, чем у AE2, лишенного аминокислот 199–524, что позволяет предположить наличие двух отдельных сайтов связывания L-IRBIT на N-конце. AE2, а именно 76–199 а.о. и 199–347 а.о. (рис. 4А). В самом деле, если а.о. 199–347 удалены из AE2, мутант демонстрирует гораздо более слабую силу связывания с L-IRBIT, чем AE2 дикого типа. Это означает, что а.о. 348–524 может вести себя как область, ингибирующая связывание L-IRBIT с а.о. 76–19.9, и что область а.о. 199–347 может также играть роль супрессора опосредованного а. о. 348–524 ингибирования.

Рисунок 4

His-кластер в N-концевой области AE2 участвует во взаимодействии между AE2 и белками семейства IRBIT. ( A ) Схематическая диаграмма делеционных мутантов AE2, меченных GFP (верхняя панель). Выравнивание последовательностей N-концевых областей (аминокислоты 55–111, у мышей) различных видов AE2. Красные буквы обозначают кластеры основных аминокислот и обозначаются как His-кластер, 1-й кластер R/K и 2-й кластер R/K соответственно. mAE2: мышь AE2, NM_009207,3; hAE2: humanAE2, NM_003040.4; cAE2: цыпленокAE2, NM_204963.1; zAE2: рыбка данио AE2, NM_001037237.1 (нижняя панель). ( B ) L-IRBT с меткой FLAG трансфицировали в Т-клетки HEK 293 отдельно или с помощью AE2 с меткой GFP. Лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с каждым указанным антителом (IP). Коиммунопреципитацию анализировали с помощью иммуноблотов с указанными антителами (IB) (левая панель). Эффективность связывания каждого укороченного мутанта AE2 с L-IRBIT рассчитывали на основе сигналов GFP ко-иммунопреципитации/вводимых сигналов. Относительная эффективность связывания каждого усеченного мутанта AE2 представлена ​​в процентах от эффективности AE2 дикого типа (100%), N = 3.* P  < 0,05, NS (не имеет значения) (правая панель). ( C , D ) L-IRBIT, меченный FLAG, трансфицировали в T-клетки HEK 293, и лизат вытягивали вниз каждым меченным GST слитым белком, несущим указанную N-концевую область с мутациями AE2 или без них. Связанный L-IRBIT исследовали с помощью иммуноблоттинга и антител против FLAG. ( E ) HA-меченый AE2 дикого типа или мутант (аминокислоты 78–82) трансфицировали в Т-клетки HEK 293 отдельно или с FLAG-меченым семейством IRBIT. Лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с каждым указанным антителом (IP). Коиммунопреципитацию анализировали с помощью иммуноблотов с указанными антителами (ИБ).

Изображение полного размера

NBCe1B имеет характерные кластеры положительно заряженных остатков в N-концевой области 25 . Сообщалось, что IRBIT связывается с NBCe1B и усиливает его, и что три консервативных остатка аргинина в N-концевой области необходимы для взаимодействия между IRBIT и NBCe1B 25 . По аналогии с этими выводами мы исследовали N-концевую последовательность AE2 и обнаружили кластеры основных остатков в мышином AE2, которые консервативны у разных видов (рис. 4А). Таким образом, мы сосредоточились на N-концевой области от 1–19 а.о.8, и получили GST-слитые белки, несущие различные части N-концевой а. анализ вниз. Как и ожидалось, меченый GST AE2-aa1-198 связывался с L-IRBIT (рис. 4C). AE2-aa1-111, меченный GST, связывался с L-IRBIT в той же степени, что и AE2-aa1-198, меченный GST, что позволяет предположить, что а.о. 112–198 не участвует в связывании (рис. 4C). AE2-aa1-111 действительно включает кластеры основных остатков, которые разделены на три части: His-кластер, 1-й кластер Arg и 2-й кластер Arg (рис. 4A). Чтобы исследовать, какая часть (части) является (являются) критической для связывания L-IRBIT, слитые белки GST-меченого AE2 были дополнительно усечены и исследованы на связывание с L-IRBIT. Анализ с вытягиванием вниз продемонстрировал надежное связывание AE2-aa1-100, меченного GST, с L-IRBIT, что позволяет предположить, что 2-й кластер Arg не участвовал во взаимодействии, в то время как AE2-aa1-88, меченный GST, показал сниженное связывание ( Рис. 4D). Это свидетельствовало о том, что 1-й кластер Arg принимал активное участие во взаимодействии. При дальнейшем удалении слитые белки GST, либо AE2-aa1-75, помеченный GST, либо AE2-aa1-45, помеченный GST, больше не связываются с L-IRBIT, что указывает на то, что His-кластер незаменим для взаимодействия (рис. 4D). . Критическое участие His-кластера во взаимодействии было подтверждено обнаружением того, что меченый GST AE2-aa55-88, который включает только His-кластер и его N-концевую фланкирующую область, продемонстрировал существенное связывание с L-IRBIT (рис. 4D). . Далее мы исследовали важность кластера His и 1-го кластера Arg для взаимодействия с точечными мутациями в основных остатках. В раскрывающемся анализе оба мутанта AE2-aa 1–111 с меткой GST, AE2-aa 78AAIAA82 с меткой GST и AE2-aa 9 с меткой GST3AAA95, продемонстрировал значительно сниженное связывание с L-IRBIT, и это снижение было гораздо более очевидным в меченном GST AE2-aa 78AAIAA82, чем в GST-меченном AE2-aa 93AAA95, что позволяет предположить, что His-кластер вносил больший вклад во взаимодействие. Рис. 4D). Действительно, эксперименты по гетерологичной коэкспрессии и иммунопреципитации показали, что связывание полноразмерного AE2, мутировавшего в области 78–82 аминокислотных остатков, как с IRBIT, так и с L-IRBIT было намного слабее по сравнению со связыванием AE2 дикого типа (рис. 4E). Эти результаты показали, что для взаимодействия между AE2 и белками семейства IRBIT основные аминокислоты в N-концевой области AE2 важны для связывания с NBCe1B; однако остатки His в AE2 были более критическими, чем кластеры Arg.

Затем для определения области белков семейства IRBIT, ответственной за связывание AE2, была приготовлена ​​серия делеционных мутантов FLAG-меченого L-IRBIT (рис. 5A), и они были проверены на их связывание с полноразмерным AE2 в гетерологичной контекст выражения. Связывание между HA-меченым AE2 и полноразмерным FLAG-меченым L-IRBIT было подтверждено с помощью анализов направленной коиммунопреципитации. Если делеция произошла в консервативном спиральном семействе IRBIT плюс домен AHCY (L-IRBIT-aa1-184 с меткой FLAG на рис. 5B) или C-концевой части домена AHCY (L-IRBIT-aa1 с меткой FLAG -307), связывание между HA-меченым AE2 и укороченным FLAG-меченым L-IRBIT больше не наблюдалось. Напротив, область LISN, специфическая часть придатка L-IRBIT, была необязательна для связывания (L-IRBIT-aa107-610 с маркировкой FLAG), что согласуется с выводом о том, что как IRBIT, так и L-IRBIT обладают сопоставимой связывающей способностью. до AE2, как указано выше. Еще одна укороченная с N-конца форма FLAG-меченого L-IRBIT [FLAG-меченый L-IRBIT (аминокислоты 185–610)], в котором отсутствуют консервативные множественные сайты фосфорилирования, необходимые для связывания с различными белками-мишенями, такими как IP 9. 0005 3 R и NBCe1C 2,4 , все еще привязанные к AE2. Эти результаты свидетельствуют о том, что для связывания белков семейства IRBIT с AE2 необходима консервативная С-концевая область, включая область спиральной спирали и домен AHCY белков семейства IRBIT, и что фосфорилирование белков семейства IRBIT не является обязательным. необходимый.

Рисунок 5

С-концевой домен AHCY белков семейства IRBIT непосредственно взаимодействует с N-концевым участком AE2. ( A ) Схематическая структура белков семейства IRBIT и усеченных мутантов L-IRBIT с меткой FLAG. LISN: N-концевой домен, специфичный для Long-IRBIT; SER: область, богатая серином; CC: спиральная область; Домен AHCY: указаны домены, подобные аденозилгомоцистеингидролазе. ( B ) HA-меченый AE2 дикого типа трансфицировали в Т-клетки HEK 293 отдельно или с FLAG-меченым L-IRBIT дикого типа или с FLAG-мечеными делеционными мутантами L-IRBIT (аа 1–184, аа 1–307, аа 107 –610 и аа 185–610). Лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с каждым указанным антителом (IP). Ко-иммунопреципитаты анализировали с помощью иммуноблотов с указанными антителами (ИБ). ( C ) Очищенный слитый белок MBP (MBP или L-IRBIT, меченный MBP) подвергали нисхождению с использованием очищенного слитого белка GST (GST, GST-tagged-AE2 (aa 1–111) или GST-tagged-AE2 ( аа 78–82).Связанные белки исследовали с помощью иммуноблоттинга с анти-MBP антителами.

Изображение полного размера

Чтобы подтвердить прямое и независимое от фосфорилирования связывание белков семейства IRBIT с AE2, мы подготовили очищенные белки, несущие каждую существенную часть из E. coli , и исследовали связывание с помощью эксперимента с вытягиванием вниз. Контрольный белок, связывающий мальтозу (MBP), не подавлялся ни GST, ни GST-меченым AE2-aa1-111. Однако слитый белок MBP, несущий L-IRBIT-aa185-610, который не показал связывания с GST, был удален с помощью меченого GST AE2-aa1-111 (рис. 5C). AE2-aa1-111 с меткой GST, мутировавший в Hiss в Alas (78AAIAA82), показал сниженное связывание с L-IRBIT-aa185-610 с меткой MBP. Эти результаты ясно демонстрируют, что семейство IRBIT напрямую связывается с AE2 посредством взаимодействия между консервативным С-концевым доменом белков семейства IRBIT и N-концевой кластерной областью His AE2.

Гомультимер ИРБИТ способствует лизосомальной деградации AE2, которая подавляется включением L-ИРБИТ в мультимер

Как показано выше, AE2 является общей мишенью связывания семейства ИРБИТ. Однако снижение уровня экспрессии и, как следствие, снижение транспортной активности AE2 было обнаружено только в клетках с нокаутом L-IRBIT, но не в клетках с нокаутом IRBIT. Чтобы прояснить механизм, который объясняет несоответствие между связывающей способностью и функциональными свойствами IRBIT и L-IRBIT по отношению к AE2, мы установили клетки с двойным нокаутом IRBIT/L-IRBIT и измерили активность AE2 с помощью SNARF-1. Интересно, что активность AE2 в клетках с двойным нокаутом IRBIT/L-IRBIT была увеличена в 1,4 раза по сравнению с контрольными клетками (рис. 6А). В соответствии с этим уровень экспрессии AE2 в клетках с двойным нокаутом IRBIT/L-IRBIT повышался параллельно (фиг. 6B), а миграция клеток с двойным нокаутом IRBIT/L-IRBIT была сравнима с миграцией контрольных клеток (фиг. S2E-G). В совокупности результаты KO клеток семейства IRBIT показали, что IRBIT может функционировать как негативный регулятор уровня экспрессии AE2 и что L-IRBIT служит эндогенным конкурентом для IRBIT. Таким образом, мы попытались экспрессировать IRBIT или L-IRBIT в клетках с двойным KO и исследовали активность AE2. Как и ожидалось, если IRBIT экспрессировался в двойных клетках KO, активность AE2 снижалась (рис. 6C). Между тем, если L-IRBIT экспрессировался, активность AE2 не менялась (рис. 6C). Интересно, что как IRBIT-, так и L-IRBIT-экспрессированные клетки показали увеличение исходного pHi. Хотя механизм не ясен, это может быть связано с тем, что семейство ИРБИТ имеет несколько переносчиков ионов-мишеней и проявляет разные действия по отношению к ним 14 .

Рисунок 6

Гомультимер ИРБИТ снижает стабильность и активность AE2. ( A ) Двойные нокаутные клетки IRBIT/L-IRBIT были созданы с использованием стратегии CRISPR/Cas9, и в клетках была измерена активность AE2. Репрезентативный график изменения pHi, полученный для контроля (синий), клона 1 IRBIT/L-IRBIT DKO (красный) и клона 2 IRBIT/L-IRBIT DKO (оранжевый) (левая панель). Средняя активность AE2 (ΔpH/мин) составила 0,17±0,01 (WT), 0,26±0,02 (ИРБИТ/L-ИРБИТ ДКО1) и 0,24±0,01 (ИРБИТ/L-ИРБИТ ДКО2), N = 5 (правая панель). ( B ) Экспрессию белков IRBIT, L-IRBIT и AE2 в клетках IRBIT/L-IRBIT с двойной DKO проверяли с помощью иммуноблоттинга. ( C ) Анализировали влияние экзогенной экспрессии IRBIT или L-IRBIT на активность AE2 в клетках IRBIT/L-IRBIT DKO. Клетки, экспрессирующие IRBIT или L-IRBIT, отбирали на основании коэкспрессируемых сигналов GFP. Синяя кривая — это контрольные клетки, красная кривая — клетки IRBIT/L-IRBIT DKO, оранжевая кривая — клетки IRBIT/L-IRBIT DKO, экспрессированные с помощью IRBIT, а зеленая кривая — клетки IRBIT/L-IRBIT DKO, экспрессированные с помощью L. -ИРБИТ (левая панель). Средняя активность AE2 в каждом типе клеток составила 0,22 ± 0,04 (WT + вектор), 0,37 ± 0,03 (ИРБИТ/L-ИРБИТ ДКО + вектор), 0,24 ± 0,02 (ИРБИТ/L-ИРБИТ ДКО IR+ ИРБИТ), 0,35 0,2 /Л-ИРБИТ ДКО + Л-ИРБИТ), N = 4—5 (правая панель). Общее количество клеток указано на каждом графике. ** P  < 0,01, NS (не имеет значения).

Изображение с полным размером

Хорошо известно, что белки семейства IRBIT образуют мультимер через С-концевой домен AHCY 11 . Действительно, наш анализ ко-иммунопреципитации показал, что IRBIT и L-IRBIT существуют как гетеромультимеры (рис. 1A и таблица 1). Уровень экспрессии и активность AE2 в клетках L-IRBIT KO, но не в клетках с двойным KO, были значительно снижены, что позволяет предположить, что гомомультимер IRBIT может подавлять экспрессию AE2. Чтобы выяснить, происходит ли это подавление на уровне транскрипции, мы исследовали уровни мРНК AE2 в каждой клетке KO с помощью ПЦР в реальном времени. Уровень мРНК AE2 был почти постоянным в каждой нокаутной клетке (рис. S3A, B). Это свидетельствует о том, что гомомультимеры IRBIT могут влиять на стабильность белка AE2. Таким образом, затем мы исследовали влияние химических соединений на уровень белка AE2 с использованием бафиломицина A1 (125 нМ) и MG132 (20 мкМ), которые являются ингибиторами лизосомной деградации или протеасомной деградации соответственно. Как показано на рис. 7А, уровень белка AE2 повышался в 1,5 раза в контрольных клетках, обработанных бафиломицином А1, но не в контрольных клетках, обработанных MG132. В клетках L-ИРБИТ-КО при обработке бафиломицином А1 уровни белка АЕ2 повышались в 2,2 раза и восстанавливались до контрольного уровня. Напротив, обработка MG132 не показала каких-либо изменений в уровнях белка AE2 в клетках L-IRBIT-KO, что позволяет предположить, что связывание гомомультимера IRBIT с AE2 способствует деградации AE2 посредством эндоцитоза/лизосомного пути. Обработка MG132 в клетках IRBIT/L-IRBIT double KO и IRBIT KO не показала увеличения уровней белка AE2; однако лечение бафиломицином снова повышало уровни белка AE2 в этих клетках. Это увеличение было в меньшей степени, чем в клетках L-IRBIT KO, что позволяет предположить, что AE2 может постоянно подавляться посредством IRBIT-независимого и зависимого от эндоцитоза/лизосом пути деградации.

Рисунок 7

Связывание гомомультимера IRBIT способствует деградации AE2 по пути лизосомной деградации, а включение L-IRBIT в мультимер подавляет деградацию AE2. ( A ) Каждую нокаутную клетку семейства IRBIT обрабатывали ДМСО, бафиломицином A1 (125 нМ) или MG132 (20 мкМ) в течение 3 ч (левая панель). Влияние соединений на уровень экспрессии AE2 в каждой клетке KO оценивали путем сравнения экспрессии AE2 в клетках, обработанных соединением, с экспрессией в контрольных клетках с ДМСО, что представлено кратным увеличением, N = 5 (правая панель). ( B ) Уровень экспрессии AE2, экзогенно экспрессированного в клетках IRBIT/L-IRBIT DKO, исследовали, когда IRBIT и/или L-IRBIT коэкспрессировались с различным соотношением комбинаций. Уровни экспрессии AE2, IRBIT и L-IRBIT оценивали с помощью иммуноблота с антителами против HA (AE2) и антителами против FLAG (IRBIT и L-IRBIT). «-», «+», «⧺» указывают количество каждой плазмидной ДНК, используемой при трансфекции. Показан относительный уровень экспрессии меченого HA AE2, N = 3 (нижняя панель). ( C ) Исследовали уровень экспрессии мутантного AE2 (аминокислоты 78–82) в клетках IRBIT/L-IRBIT DKO, коэкспрессированных с IRBIT или L-IRBIT с меткой FLAG. Показан относительный уровень экспрессии мутантного HA-меченого AE2, N = 3 (нижняя панель). ( D ) Исследовали связывание мультимеров белков семейства IRBIT с AE2. AE2 дикого типа, меченный GFP, трансфицировали в клетки IRBIT/L-IRBIT DKO с помощью IRBIT, меченного HA, и/или L-IRBIT, меченного FLAG. Лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с каждым антителом против HA или антителом против FLAG (IP). Ко-иммунопреципитаты анализировали с помощью иммуноблота с указанными антителами (ИБ). * P  < 0,05, NS (не имеет значения).

Полноразмерное изображение

Для непосредственного изучения влияния гомомультимеров IRBIT на стабильность белка AE2, AE2 и IRBIT экзогенно экспрессировали в клетках с двойным нокаутом IRBIT/L-IRBIT со ступенчатым увеличением экспрессии IRBIT. Уровень экспрессии AE2 снизился, а уровень IRBIT увеличился (рис. 7B). С другой стороны, уровень экспрессии AE2 не изменился или, скорее, увеличился, если L-IRBIT экспрессировался экзогенно (фиг. 7B). Кроме того, снижение экспрессии AE2, вызванное экспрессией IRBIT, компенсировалось коэкспрессией L-IRBIT, что указывает на то, что связывание гомомультимера IRBIT способствует деградации AE2, которая ингибируется сосуществованием L-IRBIT (фиг. 7Б). Мутант AE2 (аминокислоты 78–82), демонстрирующий пониженное связывание с IRBIT, не подвергался воздействию уровня экспрессии, если он коэкспрессировался с IRBIT или L-IRBIT в клетках с двойным нокаутом IRBIT/L-IRBIT, что позволяет предположить, что деградация AE2 действительно индуцировался связыванием IRBIT (фиг. 7C). В отличие от обнаружения, что полноразмерная экспрессия L-IRBIT в клетках L-IRBIT KO восстанавливала активность AE2 (рис. 2D), экспрессия мутантных белков семейства IRBIT, лишенных связывания AE2, IRBIT (аминокислоты 1–227) или L-IRBIT ( аа 1–307), не вызывали никаких изменений активности AE2 (рис. S4A, B), что свидетельствует о том, что влияние семейства IRBIT на стабильность и активность AE2 опосредовано прямым связыванием. Более того, если IRBIT или L-IRBIT иммунопреципитировали из клеток с двойным нокаутом IRBIT/L-IRBIT, экзогенно экспрессированных с помощью AE2, было показано, что IRBIT и L-IRBIT образуют гетеромультимеры, которые связываются с AE2 в той же степени, что и гомомультимеры IRBIT или Гомультимеры L-ИРБИТ (рис. 7D), что позволяет предположить, что включение L-ИРБИТ в мультимеры уменьшало разлагающее действие гомомультимеров ИРБИТ.

Все эти данные свидетельствуют о том, что связывание гомомультимера IRBIT способствует зависимой от эндоцитоза/лизосом деградации AE2 и что L-IRBIT играет роль доминирующего негативного регулятора действия IRBIT.

Обсуждение

Мы идентифицировали AE2 как новую молекулу-мишень белков семейства IRBIT. ИРБИТ и L-ИРБИТ проявляют аналогичную связывающую способность с AE2. Интересно, что мы обнаружили, что связывание гомо-мультимера IRBIT облегчает деградацию AE2 через эндоцитоз/лизосомальный путь, тем самым подавляя активность AE2 и связанную с ней клеточную функцию. Кроме того, включение L-IRBIT в мультимер ингибировало деградацию AE2, указывая на то, что IRBIT и L-IRBIT имеют противоположные эффекты в отношении стабильности AE2. Учитывая, что соотношение экспрессии IRBIT/L-IRBIT различается в зависимости от типа клеток и может меняться в зависимости от клеточного контекста, как IRBIT, так и L-IRBIT могут скоординировано способствовать регуляции, специфичной для типа клетки и/или клеточного контекста. активности AE2.

В этом исследовании мы идентифицировали AE2 как общую мишень связывания как для IRBIT, так и для L-IRBIT, что подтверждается результатами экспериментов по биохимическому связыванию, демонстрирующих, что консервативный домен AHCY IRBIT/L-IRBIT отвечает за связывание к АЕ2. Поскольку AHCY образует мультимер 26,27 , IRBIT/L-IRBIT также образует гомо- или гетеромультимеры друг с другом через домен AHCY, а AE2 связывается с каждым мультимером, а именно гомомультимер IRBIT, гомомультимер L-IRBIT или IRBIT. /L-IRBIT гетеромультимер с аналогичной аффинностью связывания (рис. 7). Среди них только связывание гомомультимера IRBIT способствовало деградации AE2 по пути эндоцитоза/лизосомы, механизм которого до сих пор полностью не ясен. Однако, учитывая, что молекулы-мишени ИРБИТ, о которых сообщалось ранее, такие как IP 3 R и NBCe1-B, не обнаруживали признаков деградации при взаимодействии с ИРБИТ 2,4,28 , эндоцитоз/лизосомная деградация AE2, индуцированная связыванием гомомультимера ИРБИТ, вероятно, связана с некоторыми специфическими свойствами AE2 в комплексе с гомомультимером ИРБИТ и/или с некоторыми неизвестными характеристиками клеток B16–F10, которые использовались в данном исследовании. Эти вопросы должны быть выяснены в будущих экспериментах.

Насколько нам известно, этот тип регуляции переносчиков ионов двумя гомологичными связывающими белками с противоположными функциями может быть первым случаем. В других областях биологии есть аналогичный пример, случай ASPP (стимулирующий апоптоз белок p53) и iASPP (ингибиторный член семейства ASPP). ASPP и iASPP являются гомологичными белками, оба из которых связываются с p53. За счет связывания с p53 ASPP способствует апоптозу, тогда как iASPP подавляет апоптоз 29,30,31 . Наши результаты в случае ASPP/iASPP могут подразумевать потенциальное эволюционное значение дупликации генов и альтернативного сплайсинга.

Недавно мы сообщили о вариантах сплайсинга L-IRBIT, имеющих более короткую N-концевую область, чем у IRBIT, L-IRBIT V3 и L-IRBIT V4 14 . Эти варианты могут имитировать функцию IRBIT и влиять на активность AE2. Однако, учитывая, что аутентичный L-IRBIT (L-IRBIT V1 или L-IRBIT V2) преимущественно экспрессировался в клетках B16–F10 и что клетки L-IRBIT KO были получены с использованием направляющей последовательности РНК, нацеленной на общий экзон всех L -ИРБИТ, наши результаты, вероятно, отражают эффекты ИРБИТ и аутентичного L-ИРБИТ. Однако, как показано в предыдущем докладе 14 , короткие варианты L-IRBIT демонстрируют более выраженную специфичную для типа клеток экспрессию. Таким образом, особенно в некоторых типах клеток, вклад вариантов короткой формы L-IRBIT в регуляцию AE2 должен быть подтвержден в будущих исследованиях.

Опосредованная гомодимером IRBIT деградация AE2 была вызвана связыванием IRBIT с N-концевой цитоплазматической областью AE2. Мы обнаружили, что по крайней мере две области, а именно 76–199 а.о. и 199–347 а.о., были сайтами связывания IRBIT на AE2. В этом исследовании мы сосредоточились на N-концевом сайте связывания, а.о. 76–19.9, который включает три тандемных кластера основных аминокислот, и мы обнаружили, что кластер His является критическим сайтом для связывания IRBIT. Учитывая, что эти кластеры основных аминокислот консервативны среди видов (рис. 4A), регуляция экспрессии и активности AE2 семейством IRBIT, вероятно, будет консервативна за пределами вида. Задокументировано несколько случаев связывания IRBIT с кластерами основных аминокислот на его молекулах-мишенях, и большинство из них зависит от фосфорилирования IRBIT; например привязка ИРБИТ к IP 3 R или на NBCe1 2,4 . В случае связывания с AE2 фосфорилирование ИРБИТ/L-ИРБИТ, по-видимому, не требовалось. Тем не менее, изучение эффектов фосфорилирования IRBIT/L-IRBIT на аффинность связывания с AE2 и/или эффективность деградации AE2 было бы интригующим для поиска более динамичной регуляции AE2.

При RVI происходит параллельная активация NHE и AE. Гиперосмотический стресс активирует NHEs, и H + вытесняется из клеток, что приводит к увеличению pHi. Увеличение pHi уравновешивается активацией AE2, что приводит к оттоку HCO 3 и накопление Cl . В этом исследовании клетки AE2 KO не показали полного устранения RVI (рис. S1D и E), вероятно, из-за компенсаторных механизмов других переносчиков ионов, таких как активация NKCC и активация NHEs. Учитывая, что белки семейства IRBIT, особенно L-IRBIT V3, который является мощным активатором NHE3, также связываются и модулируют активность NHE3 14,32 , эффекты L-IRBIT KO на RVI могут также включать изменение Активность NHE, индуцированная L-IRBIT KO.

Сообщалось, что N-концевая цитоплазматическая область AE2 отвечает за его активацию при внутри- и внеклеточных изменениях pH или осмолярности. Основная ответственная область определяется как область 300–400 а.е. AE2 19,23,33,34,35 . Эта N-концевая область частично перекрывается со вторичным сайтом связывания IRBIT, а.о. 199–347, который мы не рассматривали в этом исследовании. Учитывая, что изменения внеклеточного рН или осмолярности индуцируют активацию множественных сигнальных путей, включая события фосфорилирования/дефосфорилирования, было бы целесообразно проверить фосфорилирование зависимости взаимодействия между IRBIT и вторичным сайтом связывания AE2, а.о. 190–347 и возможность участия ИРБИТ в активации АЕ2 при изменении рН или осмолярности.

Многие типы переносчиков ионов играют решающую роль в процессах клеточной миграции как в физиологических, так и в патофизиологических условиях, и AE2 является одним из них 36,37 . Действительно, мы подтвердили важность AE2 в миграции клеток, о чем свидетельствует фенотип клеток B16-F10 с нокаутом AE2 (рис. S2C, D), и несколько доказательств показали, что белки семейства IRBIT участвуют в регуляции клеточной миграции с помощью модуляция уровня экспрессии AE2. Мы рассмотрели общие уровни клеточной экспрессии AE2; однако для направленной миграции клеток решающее значение имеют асимметричная локализация AE2 и его локальная активность 21,22 . Кроме того, у мышей AE2 KO обнаруживаются аномалии, такие как ахлоргидрия 38 , остеопетроз 39 и фертильность, связанная с тестикулярной дисплазией 40 , что указывает на возможное участие белков семейства IRBIT в регулирующем механизме секреции кислоты, дифференцировке остеокластов и сперматогенезе. Таким образом, в будущих исследованиях мы намерены выяснить влияние белков семейства IRBIT на субклеточную экспрессию AE2 и участие этой регуляции в патофизиологических условиях, что может привести к открытию потенциальных терапевтических мишеней для метастазирования рака и выяснению его патофизиология.

Материалы и методы

Клеточная культура и трансфекция

Клеточные линии меланомы B16-F10 были любезно предоставлены доктором Сусуму Ито (Фармацевтический университет Шова, Токио, Япония). Т-клетки B16–F10 и HEK-293 поддерживали в модифицированной Дульбекко среде Игла (DMEM) с добавлением 10% эмбриональной бычьей сыворотки, 50 единиц/мл пенициллина и 50 мкг/мл стрептомицина. Т-клетки B16–F10 и HEK-293 временно трансфицировали различными конструкциями с использованием полиэтиленимина (Polysciences).

Плазмиды, рекомбинантные белки

Экспрессионные плазмиды млекопитающих, кодирующие FLAG-меченый IRBIT дикого типа и FLAG-меченый L-IRBIT дикого типа, были описаны ранее 2,11 . Делеционные мутанты L-IRBIT с меткой FLAG (аминокислоты 1–184, аминокислоты 1–307, аминокислоты 107–610 и аминокислоты 185–610) были сконструированы с использованием сайт-направленного мутагенеза на основе ПЦР. Полноразмерную кДНК мышиного AE2 приобретали у Danaform. кДНК, кодирующую N-концевой HA-меченый AE2, амплифицировали с помощью ПЦР и субклонировали в вектор pcDNA3.1 (+) (Life Technologies).

Бактериальные экспрессионные плазмиды, кодирующие различные N-концевые части AE2 и различные области L-IRBIT, были сконструированы путем субклонирования каждого фрагмента, амплифицированного с помощью ПЦР, в вектор экспрессии E. coli pGEX5x-3 (GE Healthcare) и pMAL-c5x (New England BioLabs) соответственно. Последовательности ДНК всех сконструированных плазмид были проверены с помощью секвенирования ДНК.

Антитела

Используемые антитела: кроличьи антитела против IRBIT 1 и кроличьи антитела против L-IRBIT 11 . Кроличьи антитела к AE2 (Santa Cruz, кат. № sc-376632), мышиные антитела к FLAG (кат. № 014-22383), кроличьи антитела к НА (Roche, кат. № 11867423001), мышиные антитела к GFP ( Санта-Крус, кат. № sc-9996), мышиное антитело против β-актина (Санта-Круз, кат. № sc-69879), мышиное антитело против MBP (Санта-Крус, кат. № sc-13564).

Получение клеток B16-F10 с нокаутом IRBIT, L-IRBIT или AE2 с использованием CRISPR/Cas9-опосредованного редактирования генома

Целевые последовательности для интерференции CRISPR были разработаны с использованием CRISPR direct 41 . Целевыми последовательностями, используемыми для мышиных IRBIT, L-IRBIT и AE2, были CCCTACTAAGACTGGCCGGAGAT (IRBIT KO1, IRBIT KO2), TGGCAAGAGGATAGTACTGCTGG (L-IRBIT KO1), LCAGAGCAGATTCCGTTAGGCAGG (L-IRBIT KO2) и CCTCCAGGAGGCTGGATCCCGGG (AE2). Два комплементарных олигонуклеотида с сайтами рестрикции BpiI для направляющих РНК (гРНК) были синтезированы в Sigma-Aldrich и клонированы в вектор pX459 CRISPR/Cas9-Puro (Addgene).

Иммуноблоттинг

Белки разделяли с помощью SDS-PAGE и переносили на поливинилидендифторидную мембрану. Мембрану блокировали обезжиренным молоком с концентрацией 5,0% (вес/объем) в PBS в течение 1 ч и зондировали первичным антителом в течение ночи при 4 °C. После промывки PBS, содержащим 0,05% (масса/объем) Tween-20 (PBST), мембраны инкубировали с соответствующим вторичным антителом, конъюгированным с HRP, и сигналы регистрировали с использованием субстрата Immoblilon Forte Western HRP (Millipore).

Иммунопреципитация

Для иммунопреципитации Т-клетки HEK 293, экспрессирующие L-IRBIT с меткой FLAG и AE2 с меткой HA, промывали PBS и солюбилизировали в лизирующем буфере (10 мМ HEPES [pH 7,4], 100 мМ NaCl, 2 мМ ЭДТА, 0,1% Triton X-100, 10 мМ фторида натрия, смесь ингибиторов протеаз (без ЭДТА) (Nacalai Tesque). Гомогенат центрифугировали при 20 000 × г в течение 15 минут. Надосадочную жидкость предварительно очищали с помощью Protein G Sepharose (GE Healthcare). и инкубировали с соответствующими антителами и белком-G в течение ночи при 4 ° C. Затем гранулы пять раз промывали лизирующим буфером, а белки элюировали кипячением в буфере для образцов SDS/PAGE.

Визуализация внутриклеточного pH

Внутриклеточный pH измеряли путем регистрации интенсивности флуоресценции 5-(и-6)-карбокси SNARF-1-AM (Roche) при длинах волн излучения 580 и 640 нм с длиной волны возбуждения 488 нм с использованием конфокального микроскоп (A1R, Nikon Instruments). Эти клетки перфузировали буфером Рингера, содержащим следующее: 5 мМ глюкозы, 5 мМ глюконата калия, 1 мМ глюконата кальция, 1 мМ MgSO 4 , 2,5 мМ NaH 2 PO 4 ・2H 2 O, 25 мМ NaHCO 3 , 10 мМ HEPES (pH 7,4, NaOH), содержащий 140 мМ NaCl (содержащий Cl ) или 140 мМ глюконата натрия (Cl свободный). Для визуализации внутриклеточного рН клетки выращивали на стекле, покрытом поли-L-лизином, за 24 часа до этого. SNARF-1 (20 мкМ) загружали с помощью Cl , содержащего буфер Рингера, и инкубировали в течение 10 мин при комнатной температуре. Во время измерения перфузионные растворы непрерывно барботировали 5% CO 2 при 37 °C. Для стабилизации клетки перфузировали Cl , содержащие буфер Рингера, в течение 10 мин, а внутриклеточный рН измеряли с интервалами в 6 с. После перфузии клеток Cl , содержащим буфер Рингера, в течение 5 мин, буфер заменяли буфером Рингера, свободным от Cl , на 10 мин. Для количественной оценки интересующие области (ROI) помещали на отдельные клетки, и из каждой ROI извлекали сигналы флуоресценции. В одном эксперименте анализировали 30 клеток. Наносили на график средние значения pHi из 3 независимых экспериментов. Активность AE2 определяли с помощью линейной регрессии подщелачивания от каждой клетки 42 . pHi был представлен отношением флуоресценции SNARF-1 (640 нм/580 нм) 43 , а калибровка была выполнена с использованием 11 мкМ нигерицина в буфере HEPES: 126 мМ NaCl, 4,4 мМ KCl, 11 мМ глюкозы, 1,1 мМ CaCl 2 . , 1 мМ MgCl 2 и 24 мМ HEPES-Na при pH 6,8, 7,0, 7,4, 7,8 и 8,0.

Измерение объема клеток

Изменения объема клеток в клетках B16-F10 измеряли с использованием метода самогашения кальцеином 20 . Эти клетки перфузировали изотоническим буфером или гипертоническим буфером, содержащим следующее: 10 мМ глюкозы, 2 мМ KCl, 2 мМ KH 9.0005 2 PO 4 , 2 мМ CaCl 2 , 2 мМ MgCl 2 , 20 мМ D-маннита, 25 мМ NaHCO 3 и 10 мМ 3, мМ HEPES 07M (p NaCl (изотонический) или 205 мМ NaCl (гипертонический). Для измерения объема клеток в условиях гипертонического стресса клетки высевали на покровные стекла, покрытые поли-L-лизином, за 24 часа до этого. Перед измерениями 40 мкМ кальцеин-АМ (eBioscience) загружали изоосмотическим буфером и инкубировали в 5% CO 2 при 37 °C в течение 1 часа. До гиперосмотической нагрузки флуоресценция (EX: 488 нм, Em: 580 нм, F ) измеряли в 5% CO 2 при 37 °C в течение 10 минут с интервалами в 15 секунд с использованием конфокального флуоресцентного микроскопа (A1R, Nikon Instruments). Сигналы флуоресценции получали от каждой ROI, которая была помещена на отдельные клетки. Эффективность RVI (%) показывает скорость восстановления через 20 минут после уменьшения объема клетки и определялась по формуле (( F 20 мин – F минимум)/( F 0 мин – F минимум)) × 100 с использованием флуоресценции в 0 мин ( F 0 мин), флуоресценция сразу после гипертонического стресса (минимум F ) и флуоресценция через 20 мин после гипертонического стресса ( F 20 мин). Были нанесены средние значения эффективности RVI (%) из 3 независимых экспериментов. Калибровку проводили с буфером HEPES 300, 375, 450, 525 и 600 мОсм: 130 мМ, 167,5 мМ, 205 мМ, 242,5 мМ или 280 мМ NaCl, 4,4 мМ KCl, 11 мМ глюкозы, 1,1 мМ CaCl 2

5 2

1 мМ MgCl 2 и 24 мМ HEPES (pH 7,4, NaOH). Ф / F 0 мин был преобразован в относительный объем клетки с использованием значения F , соответствующего каждой осмоляльности (π), и создания калибровочной кривой (ось Y: F (300–600 мОсм)/ F (300 мОсм), ось X: π (300 мОсм)/π (300–600 мОсм). Используя точку пересечения оси Y (fb) от приблизительной прямой линии каждого графика, относительный объем ячейки был определен как (( F / F 0) – fb)/(1 – fb).0007 4 клеток на лунку и инкубировали при 37 °C с 5% CO 2 в DMEM с 0,5% FCS. Клетки отделяли от колб с помощью трипсин-ЭДТА в дни 0 и 1 и определяли плотность клеток с помощью гемоцитометра.

Анализ клеточной миграции

Способность к клеточной миграции оценивали с помощью анализа клеточной миграции в основном в соответствии с предыдущим отчетом 35 . То есть клетки B16-F10 высевали до слияния 4 × 10 5 клеток в 6-луночные планшеты для тканевых культур и клетки выдерживали в течение ночи в DMEM с 0,5% FCS. Наносили рану с помощью стерильного наконечника микропипетки. Плавающие клетки удаляли промыванием свежей DMEM с добавлением 0,5% FCS. Клетки фотографировали сразу после образования раны, а затем в указанные моменты времени с использованием инвертированного микроскопа CKX41 (Olympus), объектив × 4. Заживление ран количественно оценивали с использованием программного обеспечения ImageJ в виде процентной доли закрытой площади раны.

Анализ GST pull-down

Слитые белки GST, содержащие N-концевую область AE2, и слитый белок MBP L-IRBIT экспрессировали в E. coli . E. coli лизировали с использованием ультразвука в лизирующем буфере (40 мМ Tris-HCl pH 7,5, 100 мМ NaCl, 5 мМ EDTA, 0,5% Triton X-100), и лизаты центрифугировали при 10 000 × г в течение 15 мин. Супернатанты инкубировали с гранулами глутатион-сефарозы 4B (GE Healthcare) или амилозной смолой (New England Biolabs) в течение 1 часа при 4 °C и пять раз промывали лизисным буфером. Слитый белок MBP, связанный с амилозой, элюировали буфером для лизиса, содержащим 10 мМ мальтозы. Трансфицированный НЕК 293 Т-клетки лизировали в лизирующем буфере (10 мМ HEPES [pH 7,4], 100 мМ NaCl, 2 мМ ЭДТА, 0,1% Triton X-100, 10 мМ фторида натрия, смесь ингибиторов протеазы (без ЭДТА)). Очищенный слитый белок MBP или лизаты Т-клеток HEK 293 инкубировали со слитым белком GST, связывающим глутатион-сефарозу 4B, в течение 4 часов при 4 °C. После тщательной промывки глутатион-сефарозы 4B вытянутые вниз белки исследовали с помощью SDS-PAGE с последующим окрашиванием белков CBB или иммуноблоттингом.

Количественная ПЦР с обратной транскрипцией (кПЦР)

Тотальную РНК выделяли из культивируемых клеток с помощью мини-набора RNeasy Plus (QIAGEN) в соответствии с инструкциями производителя. Тотальную РНК (500 нг) подвергали обратной транскрипции в комплементарную ДНК первой цепи (кДНК) с использованием олиго-dT праймеров и мастер-микса для количественной ПЦР ReverTra Ace с gDNA Remover (TOYOBO). кПЦР проводили с использованием набора SYBR Green PCR (Thermo Fisher Scientific) с использованием системы ПЦР в реальном времени StepOne и StepOnePlus (Applied Biosystems). Эксперименты с КПЦР проводили в трех повторностях, а относительную экспрессию РНК измеряли с помощью 2- −ΔΔCt метод 44 . мРНК AE2 нормализовали по глицеральдегид-3-фосфатдегидрогеназе (GAPDH). Специфические праймеры, использованные в количественной ПЦР, были следующими: AE2, 5′-GCACCGCAGCTACAACCTTC-3′ и 5′-AGCGTCTGGGCCTCAATCTC-3′ 45 ; и для GAPDH, 5′-ATCACTGCCACCCAGAAGAC-3′ и 5′-AGGAGACAACCTGGTCCTCA-3′.

Статистический анализ

Все статистические анализы проводились с использованием EZR (Медицинский центр Сайтама, Медицинский университет Дзичи, Сайтама, Япония) 46 . Значимость различий между двумя независимыми группами данных анализировали с помощью t-критерия Стьюдента. Другие статистические данные были проанализированы с использованием однофакторного дисперсионного анализа и множественных сравнений Даннета post hoc или тестов Тьюки HSD. Каждый эксперимент был повторен не менее трех раз, и данные представлены как среднее значение ± SEM, * P   < 0,05, ** P   < 0,01 и *** P   < 0,001.

Ссылки

  1. Андо, Х., Мизутани, А., Мацу-ура, Т. и Микошиба, К. ИРБИТ, новый инозитол-1,4,5-трифосфат (IP 3 ) белок, связывающийся с рецептором, высвобождается из рецептора IP 3 при связывании IP 3 с рецептором. Дж. Биол. хим. 278 , 10602–10612 (2003 г.).

    КАС пабмед Статья Google ученый

  2. Андо Х. и др. ИРБИТ подавляет активность рецептора IP 3 , конкурируя с IP 3 за общий сайт связывания на рецепторе IP 3 . Mol.. Cell 22 , 795–806 (2006).

    КАС пабмед Статья Google ученый

  3. Кавааи, К. и др. ИРБИТ регулирует активность CaMKIIальфа и способствует гомеостазу катехоламинов посредством фосфорилирования тирозингидроксилазы. Проц. Натл. акад. науч. США 112 , 5515–5520 (2015).

    ОБЪЯВЛЕНИЯ КАС пабмед Статья ПабМед Центральный Google ученый

  4. Ширакабе, К. и др. IRBIT, белок, связывающий рецептор инозитол-1,4,5-трифосфата, специфически связывается и активирует Na + /HCO 3 котранспортера 1 поджелудочной железы (pNBC1). Проц. Натл. акад. науч. США 103 , 9542–9547 (2006 г.).

    ОБЪЯВЛЕНИЯ КАС пабмед Статья ПабМед Центральный Google ученый

  5. Девогелэре, д. и др. Протеинфосфатаза-1 является новым регулятором взаимодействия между IRBIT и рецептором инозитол-1,4,5-трифосфата. Биохим. J. 407 , 303–311 (2007).

    КАС пабмед ПабМед Центральный Статья Google ученый

  6. Park, S., Hong, J.H., Ohana, E. & Muallem, S. Пути WNK/SPAK и IRBIT/PP1 в транспорте эпителиальной жидкости и электролитов. Физиология 27 , 291–299 (2012).

    КАС пабмед Статья Google ученый

  7. Андо, Х., Кавааи, К., Бонно, Б. и Микошиба, К. Ремоделирование передачи сигналов Ca 2+ при раке: регуляция инозитол-1,4,5-трифосфатных рецепторов с помощью онкогенов и опухолевых супрессоров. Доп. биол. Регул. 68 , 64–76 (2018).

    КАС пабмед Статья Google ученый

  8. Андо Х., Кавааи К. и Микошиба К. ИРБИТ: Регулятор ионных каналов и переносчиков ионов. Биохим. Биофиз. Acta 1843 , 2195–2204 (2014).

    КАС пабмед Статья Google ученый

  9. Андо, Х., Мизутани, А. и Микошиба, К. Гомолог ИРБИТ не обладает активностью связывания с инозитол-1,4,5-трифосфатным рецептором из-за уникального N-концевого отростка. Дж. Нейрохим. 109 , 539–550 (2009).

    КАС пабмед Статья Google ученый

  10. Yamaguchi, S. & Ishikawa, T. AHCYL2 (long-IRBIT) в качестве регулятора потенциала электрогенного Na + -HCO 3 котранспортера NBCe1-B. Письмо ФЭБС. 588 , 672–677 (2014).

    КАС пабмед Статья Google ученый

  11. Park, P.W., Ahn, J.Y. & Yang, D. Ahcyl2 активирует NBCe1-B посредством нескольких остатков серина в ассоциации, опосредованной доменом PEST. Корейский J. Physiol. Фармакол. 20 , 433–440 (2016).

    КАС пабмед ПабМед Центральный Статья Google ученый

  12. Кавааи, К. и др. Вариант сплайсинга long-IRBIT определяет целевую селективность белков семейства IRBIT. Проц. Натл. акад. науч. США 114 , 3921–3926 (2017).

    КАС пабмед Статья ПабМед Центральный Google ученый

  13. Хоффманн, Э. К., Ламберт, И. Х. и Педерсен, С. Ф. Физиология регуляции объема клеток у позвоночных. Физиол. Ред. 89 , 193–277 (2009).

    КАС пабмед Статья Google ученый

  14. Jentsch, T. J. VRACs и другие ионные каналы и транспортеры в регуляции клеточного объема и не только. Нац. Преподобный Мол. Клеточная биол. 17 , 293–307 (2016).

    КАС пабмед Статья Google ученый

  15. Кейси Дж. Р., Гринштейн С. и Орловски Дж. Сенсоры и регуляторы внутриклеточного рН. Нац. Преподобный Мол. Клеточная биол. 11 , 50–61 (2010).

    КАС пабмед Статья Google ученый

  16. КазукиНакамура, Н.Ю., Ямагути, Ю., Кагота, С., Шнозука, К. и Кунитомо, М. Характеристика клеточных линий меланомы мыши по их фатальной злокачественности с использованием экспериментальной метастатической модели. Науки о жизни. 70 , 791–798 (2002).

    Артикул Google ученый

  17. Хамфрис Б.Д., Цзян Л., Чернова М.Н. и Альпер С.Л. Гипертоническая активация анионообменника AE2 в ооцитах Xenopus посредством NHE-опосредованного внутриклеточного подщелачивания. 901:13 утра. Дж. Физиол. 268 , C201–C220 (1995).

    КАС пабмед Статья Google ученый

  18. Хаманн, С. и др. Измерение изменения объема клеток путем самогашения флуоресценции. J. Флуоресц. 12 , 139–145 (2002).

    КАС Статья Google ученый

  19. Кляйн М., Сигер П., Шурихт Б., Альпер С. Л. и Шваб А. Поляризация Na + /H + и Cl /HCO 3 обменники в мигрирующих клетках почечного эпителия. J. Общая физиол. 115 , 599–608 (2000).

    КАС пабмед ПабМед Центральный Статья Google ученый

  20. Свастова Е. и др. Карбоангидраза IX взаимодействует с переносчиками бикарбоната в ламеллоподиях и увеличивает миграцию клеток через свой каталитический домен. Дж. Биол. хим. 287 , 3392–3402 (2012).

    КАС пабмед Статья Google ученый

  21. Alper, S.L. Молекулярная физиология анионообменников SLC4. Экспл. Физиол. 91 , 153–161 (2006).

    ОБЪЯВЛЕНИЯ КАС пабмед Статья Google ученый

  22. Kurtz, I. & Zhu, Q. Структура, функция и регуляция транспортера SLC4 NBCe1 и его роль в возникновении ацидоза проксимальных почечных канальцев. Курс. мнение Нефрол. гипертензии. 22 , 572–583 (2013).

    КАС пабмед ПабМед Центральный Статья Google ученый

  23. Мэри, А. Т., Борхардт, Р. Т., Хершфилд, М. С., Дэвид Смит, Г. и ЛиннХауэлл, П. Определение структуры селенометионил-S-аденозилгомоцистеингидролазы с использованием данных для одной длины волны. Нац. Структура биол. 5 , 369–376 (1998).

    Артикул Google ученый

  24. Ху, Ю. и др. Кристаллическая структура S-аденозилгомоцистеингидролазы из печени крысы. Биохимия 38 , 8323–8333 (1999).

    КАС пабмед Статья Google ученый

  25. Бергамаски, Д. и др. Онкопротеин iASPP является ключевым ингибитором p53, консервативным от червя к человеку. Нац. Жене. 33 , 162–167 (2003).

    КАС пабмед Статья Google ученый

  26. Салливан, А. и Лу, X. ASPP: Новое семейство онкогенов и генов-супрессоров опухолей. Бр. Дж. Рак 96 , 196–200 (2007).

    КАС пабмед ПабМед Центральный Статья Google ученый

  27. Амир А.И. и др. Белки с высокой степенью гомологичности проявляют противоположную биологическую активность, используя различные интерфейсы взаимодействия. Науч. Респ. 5 , 11629 (2015).

    ОБЪЯВЛЕНИЯ пабмед Статья Google ученый

  28. He, P., Klein, J. & Yun, C.C. Активация обменника NHE3 Na + /H + ангиотензином II опосредуется инозитол-1,4,5-трифосфатом (IP 3 ) рецептор-связывающий белок, высвобождаемый с помощью IP 3 (ИРБИТ) и Ca 2+ /кальмодулинзависимой протеинкиназы II. Дж. Биол. хим. 285 , 27869–27878 (2010).

    КАС пабмед ПабМед Центральный Статья Google ученый

  29. Чжан Ю., Чернова М. Н., Стюарт-Тилли А. К., Цзян Л. и Альпер С. Л. Цитоплазматический и трансмембранный домены AE2 способствуют регуляции анионного обмена посредством pH. Дж. Биол. хим. 271 , 5741–5749 (1996).

    КАС пабмед Статья Google ученый

  30. Чернова М. Н., Цзян А. К., Фридман Д. Дж., Кунес Ю. З. и Альпер С. Л. Структурно-функциональные взаимосвязи регуляции AE2 Cai 2+ -чувствительными стимуляторами NH 4+ и гипертоничность. утра. Дж. Физиол. Клеточная физиол. 284 , 1235 (2003).

    Артикул Google ученый

  31. Уэбб, Б. А., Чименти, М., Якобсон, М. П. и Барбер, Д. Л. Нерегулируемый рН: идеальный шторм для прогрессирования рака. Нац. Преподобный Рак 11 , 671–677 (2011).

    КАС пабмед Статья Google ученый

  32. Gawenis, L. R. et al. Мыши с целенаправленным разрушением обменника AE2 Cl /HCO 3 являются ахлоргидрическими. Дж. Биол. хим. 279 , 30531–30539 (2004 г.).

    КАС пабмед Статья Google ученый

  33. Кури, Ф. и др. SLC4A2-опосредованная активность Cl /HCO 3 необходима для кальпаин-зависимой регуляции актинового цитоскелета в остеокластах. Проц. Натл. акад. науч. США 110 , 2163–2168 (2013).

    ОБЪЯВЛЕНИЯ КАС пабмед Статья ПабМед Центральный Google ученый

  34. Наито, Ю., Хино, К., Боно, Х. и Уи-Тей, К. CRISPRdirect: Программное обеспечение для разработки направляющей РНК CRISPR/Cas с уменьшенным числом нецелевых сайтов. Биоинформатика 31 , 1120–1123 (2015).

    КАС пабмед Статья Google ученый

  35. Кейси, Дж. Р., Слай, В. С., Шах, Г. Н. и Альварез, Б. В. Бикарбонатный гомеостаз в возбудимых тканях: роль обменника AE3 Cl-/HCO3- и взаимодействия карбоангидразы XIV. утра. Дж. Физиол. Клетка. Физиол. 297 , C1091-1102 (2009).

    КАС пабмед Статья Google ученый

  36. Ливак, К. Дж. и Шмиттген, Т. Д. Анализ данных относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метода 2 ΔΔCt . Methods 25 , 402–408 (2001).

    КАС Статья пабмед Google ученый

  37. Taylor-Burds, C., Cheng, P. & Wray, S. Аккумуляторы хлорида NKCC1 и AE2 в нейронах GnRH мыши: последствия для возбуждения, опосредованного ГАМК. PLoS ONE 10 , e0131076 (2015).

    ПабМед ПабМед Центральный Статья КАС Google ученый

  38. Как IRBIT, так и long-IRBIT связываются с Cl-/HCO3-обменником AE2 и координированно регулируют его активность посредством модулирования лизосомальной деградации AE2

Сохранить цитату в файл

Формат: Резюме (текст)PubMedPMIDAbstract (текст)CSV

Добавить в коллекции

  • Создать новую коллекцию
  • Добавить в существующую коллекцию

Назовите свою коллекцию:

Имя должно содержать менее 100 символов

Выберите коллекцию:

Не удалось загрузить вашу коллекцию из-за ошибки
Повторите попытку

Добавить в мою библиографию

  • Моя библиография

Не удалось загрузить делегатов из-за ошибки
Повторите попытку

Ваш сохраненный поиск

Название сохраненного поиска:

Условия поиска:

Тестовые условия поиска

Эл. адрес: (изменить)

Который день? Первое воскресеньеПервый понедельникПервый вторникПервая средаПервый четвергПервая пятницаПервая субботаПервый деньПервый будний день

Который день? воскресеньепонедельниквторниксредачетвергпятницасуббота

Формат отчета: SummarySummary (text)AbstractAbstract (text)PubMed

Отправить максимум: 1 шт. 5 шт. 10 шт. 20 шт. 50 шт. 100 шт. 200 шт.

Отправить, даже если нет новых результатов

Необязательный текст в электронном письме:

Создайте файл для внешнего программного обеспечения для управления цитированием

. 2021 16 марта; 11 (1): 5990.

doi: 10.1038/s41598-021-85499-6.

Ре Ито 1 , Наоя Хатано 2 , Момоко Мураками 1 , Косуке Мицумори 1 , Сатоко Кавасаки 1 , Томока Вакаги 1 , Йошино Канзаки 1 , Хироюки Кодзима 1 , Кацухиро Кавааи 3 , Кацухико Микошиба 4 , Коити Хамада 1 , Акихиро Мизутани 5

Принадлежности

Принадлежности

  • 1 Факультет фармакотерапии, Фармацевтический университет Сёва, Матида, Токио, 194-8543, Япония.
  • 2 Отделение прикладной клеточной биологии, Высшая школа междисциплинарных наук и инженерии в системах здравоохранения, Университет Окаямы, Окаяма, 700-8530, Япония.
  • 3 Лаборатория биологии клеток и тканей, Медицинский факультет Университета Кейо, Токио, 160-8582, Япония.
  • 4 Шанхайский институт перспективных иммунохимических исследований, Шанхайский технологический университет, Шанхай, 201210, Китай.
  • 5 Кафедра фармакотерапии, Фармацевтический университет Сёва, Матида, Токио, 194-8543, Япония. [email protected]
  • PMID: 33727633
  • PMCID: PMC7966362
  • DOI: 10. 1038/с41598-021-85499-6

Бесплатная статья ЧВК

Рио Ито и др. Научный представитель .

Бесплатная статья ЧВК

. 2021 16 мар;11(1):5990.

doi: 10.1038/s41598-021-85499-6.

Авторы

Ре Ито 1 , Наоя Хатано 2 , Момоко Мураками 1 , Косуке Мицумори 1 , Сатоко Кавасаки 1 , Томока Вакаги 1 , Йошино Канзаки 1 , Хироюки Кодзима 1 , Кацухиро Кавааи 3 , Кацухико Микошиба 4 , Коити Хамада 1 , Акихиро Мизутани 5

Принадлежности

  • 1 Факультет фармакотерапии, Фармацевтический университет Сёва, Матида, Токио, 194-8543, Япония.
  • 2 Отделение прикладной клеточной биологии, Высшая школа междисциплинарных наук и инженерии в системах здравоохранения, Университет Окаямы, Окаяма, 700-8530, Япония.
  • 3 Лаборатория биологии клеток и тканей, Медицинский факультет Университета Кейо, Токио, 160-8582, Япония.
  • 4 Шанхайский институт перспективных иммунохимических исследований, Шанхайский технологический университет, Шанхай, 201210, Китай.
  • 5 Кафедра фармакотерапии, Фармацевтический университет Сёва, Матида, Токио, 194-8543, Япония. [email protected]
  • PMID: 33727633
  • PMCID: ПМС7966362
  • DOI: 10. 1038/с41598-021-85499-6

Абстрактный

Анионообменник 2 (AE2) играет решающую роль в регуляции гомеостаза клеточного объема и миграции клеток. Мы обнаружили, что как ИРБИТ, так и Лонг-ИРБИТ (L-ИРБИТ) взаимодействуют с анионообменником 2 (AE2). Взаимодействие происходило между консервативным AHCY-гомологичным доменом IRBIT/L-IRBIT и N-концевой цитоплазматической областью AE2. Интересно, что активность AE2 была снижена в клетках L-IRBIT KO, но не в клетках IRBIT KO. Кроме того, активность AE2 была немного увеличена в клетках IRBIT/L-IRBIT с двойным нокаутом. Эти изменения в активности AE2 были результатом изменений уровня экспрессии AE2 в каждой мутантной клетке и влияли на увеличение регуляторного объема и миграцию клеток. Активность и уровень экспрессии AE2 в клетках с двойным нокаутом IRBIT/L-IRBIT снижались, если IRBIT, но не L-IRBIT, снова экспрессировался в клетках, и подавление отменялось коэкспрессией L-IRBIT. Уровни мРНК AE2 в каждой клетке KO не изменились, а подавление AE2 в клетках L-IRBIT KO ингибировалось бафиломицином A1. Эти результаты показывают, что связывание IRBIT облегчает лизосомальную деградацию AE2, которая ингибируется сосуществующим L-IRBIT, что предполагает новый способ регуляции активности AE2 посредством связывания двух гомологичных белков с противоположными функциями.

Заявление о конфликте интересов

Авторы заявляют об отсутствии конкурирующих интересов.

Цифры

Рисунок 1

Белки семейства IRBIT связываются с…

Рисунок 1

Белки семейства IRBIT связываются с AE2. ( A ) Белки, связанные с ИРБИТ…

фигура 1

белка семейства IRBIT связываются с AE2. ( A ) Белки, связанные с IRBIT и L-IRBIT в клетках B16-BL6, полученные путем иммунопреципитации с использованием антител против IRBIT и против L-IRBIT, соответственно, визуализировали с использованием окрашивания серебром. Белковые полосы, указанные стрелками и стрелкой, были обработаны для анализа ЖХ-МС/МС. ( B ) IRBIT с маркировкой FLAG или L-IRBIT с маркировкой FLAG трансфицировали в Т-клетки HEK 293 отдельно или вместе с AE2 с меткой HA. Каждый лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с указанным антителом (IP). Ко-иммунопреципитаты анализировали с помощью иммуноблота с указанными антителами (ИБ).

Рисунок 2

Активность AE2 снижается в…

Рисунок 2

Активность AE2 снижается в нокаутных клетках L-IRBIT, и активность восстанавливается…

фигура 2 Активность

AE2 подавляется в нокаутных клетках L-IRBIT, и активность восстанавливается за счет экзогенной экспрессии L-IRBIT. ( A ) Нокаутные клетки IRBIT или L-IRBIT (KO) были созданы с использованием стратегии CRISPR/Cas9, и два независимых клона каждой клеточной линии KO были проверены на экспрессию IRBIT, L-IRBIT и AE2 с использованием иммуноблота (верхний панель). Показан относительный уровень экспрессии AE2 в каждой клетке KO по сравнению с контрольными клетками, N = 4 (нижняя панель). ( B ) Активность AE2 в клетках L-IRBIT KO исследовали путем измерения внутриклеточного изменения pH (ΔpHi) при замене перфузионного буфера с Cl , содержащий до Cl свободный буфер Рингера, содержащий рН-чувствительный краситель SNARF1. Репрезентативные графики изменения pHi, полученные для контроля (синий), L-IRBIT KO1 (красный) и L-IRBIT KO2 (оранжевый) (верхняя панель). Средняя активность AE2 (∆pHi/мин) каждого типа клеток составляла 0,21±0,02 (WT), 0,13±0,01 (L-IRBIT KO1) и 0,11±0,01 (L-IRBIT KO2), N = 3 (нижняя панель). . ( C ) Репрезентативный график изменения pHi, полученный для контроля (синий), ИРБИТ KO1 (красный) и ИРБИТ KO2 (оранжевый) (верхняя панель). Активность AE2 составила 0,22 ± 0,04 (WT), 0,25 ± 0,04 (ИРБИТ КО1) или 0,27 ± 0,01 (ИРБИТ КО2) соответственно, N = 4 (нижняя панель). ( D ) Эффекты экзогенной экспрессии L-IRBIT на активность AE2 в каждом типе клеток, WT, L-IRBIT KO1, L-IRBIT KO2 или двойной нокаут L-IRBIT/AE2 (DKO). Клетки, экспрессирующие L-IRBIT, отбирали на основе коэкспрессируемых сигналов GFP. Синяя кривая представляет собой имитацию контроля, а красная кривая представляет собой L-IRBIT, экспрессирующие клетки WT B16–F10 (верхняя левая панель), клетки L-IRBIT KO1 (верхняя средняя панель), клетки L-IRBIT KO2 (верхняя правая панель) и клетки с двойным нокаутом L-IRBIT/AE2 (нижняя левая панель). ( Е ) Средняя активность AE2 каждого типа клеток составила 0,15 ± 0,02 (WT + вектор), 0,20 ± 0,04 (WT + L-IRBIT), 0,10 ± 0,02 (L-IRBIT KO1 + IRvector), 0,25 ± 0,02 (L-IRBIT KO1 + IRvector), 0,25 0± 1 KOBIT (KOBIT) 0,25±2L-0,0,0,04 (WT + L-IRBIT вектор). + Л-ИРБИТ), 0,07 ± 0,01 (Л-ИРБИТ КО2 + вектор), 0,21 ± 0,02 (Л-ИРБИТ КО2 + Л-ИРБИТ), 0,02 ± 0,01 (Л-ИРБИТ/AE2 ДКО + 0вектор), 0,03 L-ИРБИТ/AE2 ДКО + L-ИРБИТ), N = 4. На каждом графике указано общее количество клеток. * P  < 0,05, ** P  < 0,01, *** P  < 0,001, NS (не значимо).

Рисунок 3

Восстановление объема клеток после гипертонической…

Рисунок 3

Восстановление объема клеток после гипертонического стресса нарушено в нокаутных клетках L-IRBIT. (…

Рисунок 3

Восстановление объема клеток после гипертонического стресса нарушено в нокаутных клетках L-IRBIT. ( A ) Восстановление объема клеток в клетках IRBIT KO измеряли на основании изменения флуоресценции при замене перфузионного буфера с буфера 300 мОсм на буфер 450 мОсм с использованием кальцеина-AM. Репрезентативные графики относительного изменения объема клеток по сравнению с исходным уровнем, полученным для контроля (синий), IRBIT KO1 (красный) и IRBIT KO2 (оранжевый) (левая панель). Эффективность RVI каждого типа клеток через 20 минут после замены буфера буфером 450 мОсм. Эффективность РВИ (%) составила 34,6 ± 13,6 (WT), 46,7 ± 5,6 (ИРБИТ КО1), 30,0 ± 7,7 (ИРБИТ КО2), N = 3–4 (правая панель). ( B ) Восстановление объема клеток L-IRBIT KO измеряли, как описано выше. Репрезентативный график относительного объема клеток для контроля (синий), L-IRBIT KO1 (красный) и L-IRBIT KO2 (оранжевый) (левая панель). Эффективность RVI каждого типа клеток составила 41,8 ± 6,1 (WT), 9,7 ± 5,6 (L-IRBIT KO1), 13,3 ± 5,0 (L-IRBIT KO2). N = 3—4 (правая панель). ( C ) Были показаны результаты анализа заживления ран. Показаны репрезентативные микрофотографии монослоя раненых клеток (левая панель). Ширина раны измерялась в 6 позициях сразу после ранения и через 18 ч у WT, ИРБИТ КО (ИРБИТ КО1, ИРБИТ КО2) и L-ИРБИТ КО (L-ИРБИТ КО1, L-ИРБИТ КО2), N = 4 (правая панель) . Общее количество клеток указано на каждом графике. * P  < 0,05, ** P  < 0,01, NS (не имеет значения).

Рисунок 4

Его кластер в N-конце…

Рисунок 4

Его кластер в N-концевой области AE2 участвует во взаимодействии…

Рисунок 4

Кластер His в N-концевой области AE2 участвует во взаимодействии между AE2 и белками семейства IRBIT. ( A ) Схематическая диаграмма мутантов с делецией AE2, меченных GFP (верхняя панель). Выравнивание последовательностей N-концевых областей (аминокислоты 55–111, у мышей) различных видов AE2. Красные буквы обозначают кластеры основных аминокислот и обозначаются как His-кластер, 1-й кластер R/K и 2-й кластер R/K соответственно. mAE2: мышиный AE2, NM_009207.3; hAE2: humanAE2, NM_003040.4; cAE2: цыпленокAE2, NM_204963.1; zAE2: рыбка данио AE2, NM_001037237. 1 (нижняя панель). ( B ) L-IRBT с меткой FLAG трансфицировали в HEK 29.3 Т-клетки отдельно или с AE2, меченным GFP. Лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с каждым указанным антителом (IP). Коиммунопреципитацию анализировали с помощью иммуноблотов с указанными антителами (IB) (левая панель). Эффективность связывания каждого укороченного мутанта AE2 с L-IRBIT рассчитывали на основе сигналов GFP ко-иммунопреципитации/вводимых сигналов. Относительная эффективность связывания каждого усеченного мутанта AE2 представлена ​​в процентах от эффективности AE2 дикого типа (100%), N = 3.* P  < 0,05, NS (не имеет значения) (правая панель). ( C , D ) L-IRBIT, меченный FLAG, трансфицировали в T-клетки HEK 293, и лизат вытягивали вниз каждым меченным GST слитым белком, несущим указанную N-концевую область с мутациями AE2 или без них. Связанный L-IRBIT исследовали с помощью иммуноблоттинга и антител против FLAG. ( E ) HA-меченый AE2 дикого типа или мутант (аминокислоты 78–82) трансфицировали в Т-клетки HEK 293 отдельно или с FLAG-меченым семейством IRBIT. Лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с каждым указанным антителом (IP). Коиммунопреципитацию анализировали с помощью иммуноблотов с указанными антителами (ИБ).

Рисунок 5

С-концевой домен AHCY…

Рисунок 5

С-концевой домен AHCY белков семейства IRBIT напрямую взаимодействует с N-концевым…

Рисунок 5

С-концевой домен AHCY белков семейства IRBIT непосредственно взаимодействует с N-концевым участком AE2. ( A ) Схематическая структура белков семейства IRBIT и укороченных мутантов L-IRBIT с меткой FLAG. LISN: N-концевой домен, специфичный для Long-IRBIT; SER: область, богатая серином; CC: спиральная область; Домен AHCY: указаны домены, подобные аденозилгомоцистеингидролазе. ( B ) HA-меченый AE2 дикого типа трансфицировали в Т-клетки HEK 293 отдельно или с FLAG-меченым L-IRBIT дикого типа или с FLAG-мечеными делеционными мутантами L-IRBIT (aa 1–184, аа 1–307, аа 107–610 и аа 185–610). Лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с каждым указанным антителом (IP). Ко-иммунопреципитаты анализировали с помощью иммуноблотов с указанными антителами (ИБ). ( C ) Очищенный слитый белок MBP (MBP или L-IRBIT, меченный MBP) был извлечен с использованием очищенного слитого белка GST (GST, GST-tagged-AE2 (aa 1–111) или GST-tagged-AE2 (aa 1–111) 78–82).Связанные белки исследовали с помощью иммуноблоттинга с антителами против MBP.

Рисунок 6

Гомультимер ИРБИТ снижает стабильность…

Рисунок 6

Гомультимер ИРБИТ снижает стабильность и активность AE2. ( А ) ИРБИТ/Л-ИРБИТ…

Рисунок 6 Гомультимер

ИРБИТ снижает стабильность и активность АЕ2. ( A ) Двойные нокаутные клетки IRBIT/L-IRBIT были созданы с использованием стратегии CRISPR/Cas9, и в клетках была измерена активность AE2. Репрезентативный график изменения pHi, полученный для контроля (синий), клона 1 IRBIT/L-IRBIT DKO (красный) и клона 2 IRBIT/L-IRBIT DKO (оранжевый) (левая панель). Средняя активность AE2 (ΔpH/мин) составила 0,17±0,01 (WT), 0,26±0,02 (ИРБИТ/L-ИРБИТ ДКО1) и 0,24±0,01 (ИРБИТ/L-ИРБИТ ДКО2), N = 5 (правая панель). ( B ) Экспрессию белков IRBIT, L-IRBIT и AE2 в клетках IRBIT/L-IRBIT с двойной DKO проверяли с помощью иммуноблоттинга. ( C ) Анализировали влияние экзогенной экспрессии IRBIT или L-IRBIT на активность AE2 в клетках IRBIT/L-IRBIT DKO. Клетки, экспрессирующие IRBIT или L-IRBIT, отбирали на основании коэкспрессируемых сигналов GFP. Синяя кривая — это контрольные клетки, красная кривая — клетки IRBIT/L-IRBIT DKO, оранжевая кривая — клетки IRBIT/L-IRBIT DKO, экспрессированные с помощью IRBIT, а зеленая кривая — клетки IRBIT/L-IRBIT DKO, экспрессированные с помощью L. -ИРБИТ (левая панель). Средняя активность AE2 в каждом типе клеток составила 0,22 ± 0,04 (WT + вектор), 0,37 ± 0,03 (ИРБИТ/L-ИРБИТ ДКО + вектор), 0,24 ± 0,02 (ИРБИТ/L-ИРБИТ ДКО IR+ ИРБИТ), 0,35 0,2 /Л-ИРБИТ ДКО + Л-ИРБИТ), N = 4—5 (правая панель). Общее количество клеток указано на каждом графике. ** P  < 0,01, NS (не имеет значения).

Рисунок 7

Гомультимерное связывание ИРБИТ облегчает…

Рисунок 7

Связывание гомомультимера IRBIT облегчает деградацию AE2 через лизосомальный путь деградации и…

Рисунок 7 Связывание гомомультимера

IRBIT облегчает деградацию AE2 по пути лизосомной деградации, а включение L-IRBIT в мультимер подавляет деградацию AE2. ( A ) Каждую нокаутную клетку семейства IRBIT обрабатывали ДМСО, бафиломицином A1 (125 нМ) или MG132 (20 мкМ) в течение 3 ч (левая панель). Влияние соединений на уровень экспрессии AE2 в каждой клетке KO оценивали путем сравнения экспрессии AE2 в клетках, обработанных соединением, с экспрессией в контрольных клетках с ДМСО, что представлено кратным увеличением, N = 5 (правая панель). ( B ) Уровень экспрессии AE2, экзогенно экспрессированного в клетках IRBIT/L-IRBIT DKO, исследовали, когда IRBIT и/или L-IRBIT коэкспрессировались с различным соотношением комбинаций. Уровни экспрессии AE2, IRBIT и L-IRBIT оценивали с помощью иммуноблота с антителами против HA (AE2) и антителами против FLAG (IRBIT и L-IRBIT). «-», «+», «⧺» указывают количество каждой плазмидной ДНК, используемой при трансфекции. Показан относительный уровень экспрессии меченого HA AE2, N = 3 (нижняя панель). ( C ) Исследовали уровень экспрессии мутантного AE2 (аминокислоты 78–82) в клетках IRBIT/L-IRBIT DKO, коэкспрессированных с IRBIT или L-IRBIT, помеченными FLAG. Показан относительный уровень экспрессии мутантного HA-меченого AE2, N = 3 (нижняя панель). ( D ) Исследовали связывание мультимеров белков семейства IRBIT с AE2. AE2 дикого типа, меченный GFP, трансфицировали в клетки IRBIT/L-IRBIT DKO с помощью IRBIT, меченного HA, и/или L-IRBIT, меченного FLAG. Лизат, экспрессирующий каждую конструкцию (входную), обрабатывали для иммунопреципитации с каждым антителом против HA или антителом против FLAG (IP). Ко-иммунопреципитаты анализировали с помощью иммуноблота с указанными антителами (ИБ). * P  < 0,05, NS (не имеет значения).

См. это изображение и информацию об авторских правах в PMC

Похожие статьи

  • Управляющий эффект регуляторных белков на активность Cl(-)/HCO3(-) обменника 2.

    Чон Й.С., Хонг Дж.Х. Чжон Ю.С. и др. Каналы (Остин). 2016;10(3):214-24. дои: 10.1080/1

  • 50.2015.1134068. Epub 2015 30 декабря. Каналы (Остин). 2016. PMID: 26716707 Бесплатная статья ЧВК.

  • Регуляция AE2-опосредованного транспорта Cl- с помощью внутриклеточного или внеклеточного рН требует высококонсервативных аминокислотных остатков Nh3-концевого цитоплазматического домена AE2.

    Стюарт А.К., Чернова М.Н., Шмуклер Б.Е., Вильгельм С., Альпер С.Л. Стюарт А.К. и соавт. J Gen Physiol. 2002 г., ноябрь; 120 (5): 707-22. doi: 10.1085/jgp.20028641. J Gen Physiol. 2002. PMID: 12407081 Бесплатная статья ЧВК.

  • Задержка клеточных хлоридов и бикарбонатов изменяет внутриклеточную регуляцию pH в эпителии крипт Cftr KO.

    Уокер Н.М., Лю Дж., Штейн С.Р., Стефански К.Д., Струбберг А.М., Кларк Л.Л. Уокер Н.М. и соавт. Am J Physiol Gastrointest Liver Physiol. 2016 г., 15 января; 310(2):G70-80. doi: 10.1152/jpgi. 00236.2015. Epub 2015 5 ноября. Am J Physiol Gastrointest Liver Physiol. 2016. PMID: 26542396 Бесплатная статья ЧВК.

  • ИРБИТ: регулятор ионных каналов и переносчиков ионов.

    Андо Х., Кавааи К., Микошиба К. Андо Х. и др. Биохим Биофиз Акта. 2014 Октябрь; 1843 (10): 2195-204. doi: 10.1016/j.bbamcr.2014.01.031. Epub 2014 8 февраля. Биохим Биофиз Акта. 2014. PMID: 24518248 Обзор.

  • Как pH регулирует регулятор pH: регуляторная горячая точка в N-концевом цитоплазматическом домене анионообменника AE2.

    Альпер С.Л., Чернова М.Н., Стюарт А.К. Альпер С.Л. и др. Клеточная биохимия Биофиз. 2002;36(2-3):123-36. дои: 10.1385/CBB:36:2-3:123. Клеточная биохимия Биофиз. 2002. PMID: 12139398 Обзор.

Посмотреть все похожие статьи

использованная литература

    1. Андо Х., Мизутани А., Мацу-ура Т., Микошиба К. ИРБИТ, новый белок, связывающий рецептор инозитол-1,4,5-трифосфата (IP3), высвобождается из рецептора IP3 при связывании IP3 с рецептором. Дж. Биол. хим. 2003; 278:10602–10612. дои: 10.1074/jbc.M210119200. – DOI – пабмед
    1. Андо Х. и др. ИРБИТ подавляет активность рецептора IP3, конкурируя с IP3 за общий сайт связывания на рецепторе IP3. Мол.. кл. 2006;22:795–806. doi: 10.1016/j.molcel.2006.05.017. – DOI – пабмед
    1. Каваи К. и др. ИРБИТ регулирует активность CaMKII-альфа и способствует гомеостазу катехоламинов посредством фосфорилирования тирозингидроксилазы. проц. Натл. акад. науч. США. 2015;112:5515–5520. doi: 10.1073/pnas.1503310112. – DOI – ЧВК – пабмед
    1. Ширакабе К. и др. IRBIT, белок, связывающий рецептор инозитол-1,4,5-трифосфата, специфически связывается и активирует котранспортер 1 Na+/HCO3- поджелудочной железы (pNBC1) Proc. Натл. акад. науч. США. 2006; 103:9542–9547. doi: 10.1073/pnas.0602250103. – DOI – ЧВК – пабмед
    1. Devogelaere B, et al. Протеинфосфатаза-1 является новым регулятором взаимодействия между IRBIT и инозитол-1,4,5-трифосфатным рецептором. Биохим. Дж. 2007; 407:303–311. DOI: 10.1042/BJ20070361. – DOI – ЧВК – пабмед

Типы публикаций

термины MeSH

вещества

Полнотекстовые ссылки

Издательская группа «Природа» Бесплатная статья ЧВК

Укажите

Формат: ААД АПА МДА НЛМ

Отправить

IRBIT контролирует апоптоз, взаимодействуя с гомологом Bcl-2, Bcl2l10, и способствуя контакту ER-митохондрий

Abstract

IRBIT представляет собой молекулу, которая взаимодействует с инозитол-1,4,5-трифосфатом (IP 3 )-связывающим карманом рецептора IP 3 (IP 3 R), в то время как антиапоптотический белок Bcl2l10 связывается с другая часть ИС 3 -связывающий домен. Здесь мы показываем, что Bcl2l10 и IRBIT взаимодействуют и оказывают аддитивное ингибирование IP 3 R в физиологическом состоянии. Более того, мы обнаружили, что эти белки объединяются в комплекс в митохондриально-ассоциированных мембранах (MAM) и что их взаимодействие участвует в регуляции апоптоза. MAM являются горячей точкой для переноса Ca 2+ между эндоплазматическим ретикулумом (ER) и митохондриями, а массивное высвобождение Ca 2+ через IP 3 R в митохондриях вызывает гибель клеток. Мы обнаружили, что при апоптотическом стрессе IRBIT дефосфорилируется, становясь ингибитором Bcl2l10. Кроме того, IRBIT способствует контакту митохондрий ER. Наши результаты показывают, что, ингибируя активность Bcl2l10 и способствуя контакту между ER и митохондриями, IRBIT способствует массивному Ca 2+ переносится в митохондрии и способствует апоптозу. Затем в этой работе IRBIT описывается как новый регулятор гибели клеток.

https://doi. org/10.7554/eLife.19896.001

Введение

Повышение внутриклеточной концентрации Ca 2+ служит вторичным мессенджером для многочисленных процессов, включая клеточный цикл, оплодотворение или апоптоз (Berridge et al., 2003). В эндоплазматическом ретикулуме (ER) сигналы Ca 2+ в основном генерируются Ca 2+ канал инозитол-1,4,5-трифосфатного рецептора (IP 3 R) в ответ на связывание IP 3 . Клеточный ответ на сигнал Ca 2+ зависит от амплитуды и частоты этого сигнала. Затем IP 3 R жестко регулируется посттрансляционными модификациями и взаимодействующими партнерами, которые модулируют высвобождение Ca 2+ в соответствии с клеточным контекстом (Mikoshiba, 2007; Foskett et al., 2007).

В частности, сообщалось, что несколько белков семейства Bcl-2 регулируют IP 3 R активность (Bonneau et al., 2013). Эти белки хорошо известны своей ролью в апоптозе посредством контроля пермеабилизации внешней митохондриальной мембраны, высвобождения цитохрома с и последующей активации каспаз (Youle and Strasser, 2008). Однако белки семейства Bcl-2 также участвуют в индуцированном Ca 2+ апоптозе. Для правильного функционирования митохондрий требуется Ca 2+ , который поставляется некоторыми частями ER, которые находятся в физическом контакте с митохондриями (называемые MAM для связанных с митохондриями мембран ER). В МАМ, IP 3 R связывается с митохондриальным потенциалзависимым анионным каналом (VDAC), обеспечивая прямой перенос Ca 2+  в митохондрии (Szabadkai et al., 2006). Однако, если количество переносимого Са 2+ слишком велико, это вызывает высвобождение цитохрома с и апоптоз. Затем было признано, что MAM являются важным компонентом Ca 2+ -индуцированного апоптоза (Giorgi et al., 2009). В связи с этим некоторые белки семейства Bcl-2 локализуются в ER и модулируют Ca 2+ 9выпуск 0008 (Bonneau et al., 2013). Некоторые антиапоптотические члены заметно взаимодействуют с IP 3 R, каждый из которых регулирует активность канала с помощью отдельного механизма. Например, Bcl-2 взаимодействует с центральной частью IP 3 R и уменьшает высвобождение Ca 2+ , чтобы ингибировать проапоптотические сигналы Ca 2+ (Hanson et al., 2008; Rong et al., 2009). Напротив, Bcl-xL взаимодействует с наиболее С-концевым доменом IP 3 R и стимулирует выживаемость Ca 2+ переходят в митохондрии (White et al., 2005).

Недавно было показано, что Nrz, гомолог Bcl-2 у рыбок данио, взаимодействует с N-концевым доменом связывания IP 3 IP 3 R и снижает связывание лиганда с рецептором, тем самым уменьшая Ca 2 + выпуск из ER (Bonneau et al., 2014). Только несколько регуляторов IP 3 R взаимодействуют со связывающим доменом IP 3 (IP 3 BD) или действуют, препятствуя фиксации лиганда. Среди них ИРБИТ действует аналогично Nrz. ИРБИТ напрямую конкурирует с IP 3 путем взаимодействия с остатками домена связывания IP 3 (IP 3 BD), которые участвуют в связывании IP 3 (известном как карман связывания IP 3 ). Это увеличивает порог IP 3 , необходимый для открытия IP 3 R, а затем снижает высвобождение Ca 2+ (Ando et al., 2006). Помимо IP 3 R, IRBIT взаимодействует с различными партнерами, такими как транспортеры и обменники ионов, включая NBCe1-B (Shirakabe et al., 2006), NHE3 (He et al., 2008) и Slc26a6 (Park et al. ., 2013), кл. канал CFTR (Yang et al., 2009), Fip1 (Kiefer et al., 2009), рибонуклеотидредуктаза (RNR) (Arnaoutov and Dasso, 2014) и киназы, включая CaMKIIα (Kawaai et al., 2015), PIPKI и IIα (Ando et al., 2015). Все эти взаимодействия затрагивают N-концевую область IRBIT, которая содержит богатую серином область с несколькими сайтами фосфорилирования (Ando et al., 2006; Devogelaere et al., 2007). В частности, фосфорилирование Ser68 необходимо для последующего последовательного фосфорилирования Ser71, Ser74 и Ser77 казеинкиназой I (Ando et al., 2006; Devogelare et al., 2007). Это множественное фосфорилирование IRBIT имеет решающее значение для его взаимодействия с IP 9. 0005 3 R и большинство других ее партнеров.

Nrz является ортологом рыбок данио антиапоптотического белка Bcl2l10 млекопитающих (также называемого Nrh, Bcl-B или Diva/Boo). На сегодняшний день мало что известно о Bcl2l10, особенно в отношении его влияния на передачу сигналов Ca 2+ . У млекопитающих Bcl2l10 в основном экспрессируется в яичниках и семенниках, а также в легких и развивающейся нервной системе (Aouacheria et al., 2001; Inohara et al., 1998). Интересно, что IRBIT также сильно экспрессируется в этих органах (Ando et al., 2003). Nrz и IRBIT регулируют IP 3 R активность при взаимодействии с IP 3 BD. Однако они не имеют общего сайта связывания на BD IP 3 , поскольку Nrz не взаимодействует с остатками, необходимыми для связывания IP 3 и IRBIT (Bonneau et al., 2014). Это говорит о том, что Nrz и IRBIT могут одновременно взаимодействовать с IP 3 BD. В настоящем исследовании мы показали, что, как и Nrz, Bcl2l10 взаимодействует с IP 3 BD IP 3 R. Затем мы проанализировали, как IRBIT и Bcl2l10 ведут себя по отношению друг к другу. Мы обнаружили, что IRBIT и Bcl2l10 взаимодействовали вместе независимо от связывания IRBIT с IP 9.0005 3 R и что они сотрудничали для регулирования деятельности IP 3 R. Кроме того, мы показали, что эти два белка локализованы в MAM, где они являются частью белкового комплекса с IP 3 R и VDAC. Неожиданно мы обнаружили, что ИРБИТ способствует гибели клеток посредством двух механизмов. Сначала во время апоптоза IRBIT дефосфорилировался, а нефосфорилированный IRBIT, по-видимому, ингибировал антиапоптотическую активность Bcl2l10. Во-вторых, IRBIT, по-видимому, способствует контакту между ER и митохондриями, что может способствовать проапоптотическому Ca 9.0007 2+ перевод. В совокупности наши результаты предполагают сильную связь между IRBIT и Bcl2l10 и впервые указывают на предполагаемое участие IRBIT в гибели клеток.

Результаты

Bcl2l10 взаимодействует с IP

3 BD и снижает высвобождение Ca 2+ из IP 3 R

Ортологическая группа Bcl2l10 сильно расходится (Guillemin et al. , 2011), и Bcl2l10 человека имеет только 28,4% идентичность с Nrz (рис. 1А). Поэтому мы сначала исследовали, ведет ли себя Bcl2l10 как Nrz и взаимодействует ли с IP 9.0005 3 R. Три различные изоформы IP 3 R были иммунопреципитированы из экстракта клеток HeLa, и мы обнаружили, что эндогенный Bcl2l10 взаимодействует с тремя изоформами, хотя взаимодействие с IP 3 R2 оказалось слабее, чем у IP . 3 R1 или IP 3 R3 (рис. 1B). Затем мы оценили, взаимодействует ли Bcl2l10 с IP 3 BD (аминокислоты 224–604 IP 3 R1), как это делает Nrz. Экстракты клеток HeLa, экспрессирующих FLAG-Bcl2l10, подвергали анализу GST-pulldown, и мы продемонстрировали, что Bcl2l10 взаимодействует с рекомбинантным GST-IP 9.0005 3 БД (рис. 1С). Было показано, что Nrz, а также Bcl-2 и Bcl-xL взаимодействуют с IP 3 R через их N-концевой домен Bh5 (Bonneau et al., 2014; Monaco et al., 2012). Делеция домена Bh5 белка Bcl2l10 (∆Bh5Bcl2l10) подавляла его взаимодействие с GST-IP 3 R∆CD (белком, в домене которого удален IP 3 R) и GST-IP 3 BD ( Рисунок 1C), демонстрирующий, что Bcl2l10 взаимодействует с IP 3 R через свой домен Bh5.

Bcl2l10 взаимодействует и регулирует IP
3 R.

( A ) Выравнивание Clustal Omega первичных структур Bcl2l10 человека и Nrz рыбок данио. Идентичные остатки выделены синим цветом. Указаны положения консервативных доменов гомологии (ВН) Bcl-2 и С-концевого трансмембранного (ТМ) домена. ( B ) Вестерн-блот иммунопреципитации (IP) между тремя эндогенными изоформами IP 3 R (IP 3 R1, IP 3 R2 и IP 3 R3) и эндогенный Bcl2l10. Антитела IgG указаны стрелками. Наконечники стрелок указывают полосы, соответствующие Bcl2l10 в IP. Вестерн-блоты являются репрезентативными для трех независимых экспериментов. ( C ) Вестерн-блоттинг GST-pulldown, выполненный с помощью GST, GST-IP 3 R∆CD или GST-IP 3 BD на лизатах клеток HeLa, экспрессирующих FLAG-Bcl2l10 или FLAG-∆Bh5Bcl2l10. Стрелками указаны полосы, соответствующие GST, GST-IP 3 R∆CD и GST-IP 3 БД. Представитель вестерн-блоттинга трех независимых экспериментов. ( D ) Левая панель: репрезентативная кривая ответа Ca 2+ клеток, нагруженных Fura-2, стимулированных 1 мкМ АТФ в указанные моменты времени. Клетки трансфицировали пустым вектором или FLAG-Bcl2l10. Базальная Fura-2 F 340 нм /F 380 нм = 0,61 ± 0,01 и 0,59 ± 0,01 для пустых клеток вектора и Bcl2l10 соответственно. Правая панель: Гистограмма, показывающая среднюю амплитуду (±SEM) АТФ-индуцированного Ca 2+ пик (n: число клеток, проанализированных в пяти независимых экспериментах). ( E ) Левая панель: репрезентативная кривая ответа клеток, нагруженных Fura-2, обработанных 1 мкМ тапсигаргина в указанные моменты времени. Правая панель: гистограмма, показывающая среднюю площадь под кривой (AUC) (±SEM) индуцированного тапсигаргином пика Ca 2+ (n: число клеток, проанализированных в трех независимых экспериментах). ***р<0,001; н.с. р>0,05.

https://doi.org/10.7554/eLife.19896.002

Затем мы исследовали влияние Bcl2l10 на IP 3 -индуцированное высвобождение Ca 2+ (IICR) в культивируемых клетках. В этих экспериментах использовали эмбриональные фибробласты мыши (MEF), поскольку они демонстрируют устойчивый IICR в ответ на стимуляцию АТФ. Экспрессия Bcl2l10 значительно снижала IICR после обработки клеток 1 мкМ АТФ, не влияя на базальную цитозольную [Ca 2+ ], как было измерено с цитозольным Ca 2+ -чувствительный краситель Фура-2 (рис. 1Г). Было показано, что белки семейства Bcl-2 могут модифицировать высвобождение Ca 2+ из ER, воздействуя на стационарную концентрацию Ca 2+ в ER (Pinton and Rizzuto, 2006). Для устранения возможного влияния Bcl2l10 на содержание ER Ca 2+ клетки MEF инкубировали с Fura-2 и обрабатывали 1 мкМ тапсигаргина, который индуцировал истощение ER [Ca 2+ ]. Мы обнаружили, что экспрессия Bcl2l10 не изменяет ER Ca 9.Содержание 0007 2+ (рис. 1Е). В совокупности эти результаты показывают, что Bcl2l10 действует подобно Nrz у рыбок данио и снижает высвобождение Ca 2+ из ER путем взаимодействия с IP 3 BD IP 3 R.

.

ИРБИТ и Bcl2l10 проявляют аддитивное ингибирование IP

3 R

IRBIT и Bcl2l10 являются одними из немногих регуляторов IP 3 R, которые взаимодействуют с IP 3 BD. Это повышает возможность кооперации или, альтернативно, конкуренции между этими двумя белками. Чтобы ответить на этот вопрос, мы сначала проанализировали влияние IRBIT и Bcl2l10 на IICR. Сверхэкспрессия IRBIT в клетках, экспрессирующих эндогенный белок, не влияет на IICR (Ando et al., 2006). Таким образом, чтобы избежать вклада эндогенного белка IRBIT, мы использовали клетки MEF, полученные от мышей с нокаутом IRBIT (KO) (Kawaai et al., 2015). В этих клетках экспрессия только IRBIT или Bcl2l10 значительно снижала IICR, вызванную обработкой АТФ, по сравнению с ответом в контроле, не влияя на базальные цитозольные [Ca 2+ ]. Интересно, что совместная экспрессия IRBIT и Bcl2l10 оказывала более сильное влияние на IICR, чем экспрессия каждого белка по отдельности (рис. 2А и В). Этот результат предполагает, что IRBIT и Bcl2l10 взаимодействуют, оказывая аддитивное ингибирование IP 3 R.

IRBIT и Bcl2l10 совместно регулируют активность IP
3 R.

( А ) Репрезентативная кривая ответа Ca 2+ клеток IRBIT KO MEF, нагруженных Fura-2, стимулированных 1 мкМ АТФ в указанные моменты времени. Клетки трансфицировали пустым вектором или плазмидой, экспрессирующей либо FLAG-Bcl2l10, либо FLAG-IRBIT по отдельности, либо FLAG-Bcl2l10 и FLAG-IRBIT вместе. Базальная Fura-2 F 340 нм /F 380 нм = 0,61 ± 0,01, 0,59 ± 0,01, 0,59 ± 0,01 и 0,58 ± 0,01 для пустого вектора, Bcl2l10, ИРБИТ и Bcl2l10+ИРБИТ соответственно. ( B ) Гистограмма, показывающая среднюю амплитуду (±SEM) АТФ-индуцированного Ca 2+ пик (n: количество клеток, проанализированных в пяти независимых экспериментах). ( C ) Вестерн-блот GST-pulldown, выполненный с GST или GST-IP 3 BD на лизатах клеток HeLa, экспрессирующих HA-IRBIT отдельно или в комбинации с FLAG-Bcl2l10. Количественную оценку проводили на основе трех независимых экспериментов. ( D ) Вестерн-блот GST-pulldown, выполненный с помощью GST-IP 3 BD на рекомбинантном Bcl2l10 отдельно или в комбинации с рекомбинантным IRBIT, полученным в Sf9клетки. Количественную оценку проводили на основе трех независимых экспериментов. ( E ) Вестерн-блот GST-pulldown, выполненный с GST-IP 3 BD на лизатах клеток HeLa, экспрессирующих HA-IRBIT отдельно или в комбинации с FLAG-Bcl2l10 в присутствии 0 , 1 или 10 мкМ IP 3 . Количественную оценку проводили из трех независимых экспериментов. *р<0,05, **р<0,01, ***р<0,001.

https://doi.org/10.7554/eLife.19896.003

Для дальнейшего изучения взаимодействия между IRBIT и Bcl2l10 мы затем изучили, влияет ли каждый из этих двух белков на взаимодействие другого с IP 3 BD. Экстракты клеток, экспрессирующих IRBIT отдельно или в комбинации с Bcl2110, подвергали GST-pulldown с рекомбинантным GST-IP 3 BD. При экспрессии с Bcl2l10 IRBIT больше взаимодействовал с IP 3 BD (рис. 2C). Таким же образом мы провели анализ GST-pulldown с GST-IP 9.0005 3 BD и рекомбинантный белок Bcl2l10 в присутствии или в отсутствие рекомбинантного IRBIT, продуцируемого в клетках Sf9. Это производство позволяет фосфорилировать IRBIT, что необходимо для взаимодействия IRBIT с IP 3 BD (Ando et al., 2006). Точно так же наши результаты показали, что в присутствии IRBIT Bcl2l10 более сильно взаимодействовал с IP 3 BD (рис. 2D). Таким образом, ИРБИТ и Bcl2l10, по-видимому, усиливали взаимодействие друг друга с IP 3 R.

IRBIT был впервые охарактеризован как белок, высвобожденный из IP 3 R посредством IP 3 (Ando et al., 2003). Действительно, поскольку ИП 3 и ИРБИТ имеют один и тот же сайт связывания, связывание ИП 3 с ИП 3 R происходит в ущерб взаимодействию ИРБИТ с ИП 3 R. Таким образом, снижение ИРБИТ взаимодействие с ИП 3 БД в присутствии возрастающей концентрации ИП 3 отражено связывание ИП 3 на рецепторе (рис. 2Е). Однако в присутствии Bcl2l10 мы заметили, что влияние IP 3 на взаимодействие IRBIT с IP 3 BD было ослаблено (рис. 2E). Этот результат подтвердил тот факт, что Bcl2l10 усиливал взаимодействие IRBIT с IP 3 R, и предположил, что Bcl2l10 и IRBIT связаны, препятствуя связыванию IP 3 с рецептором, а затем снижают высвобождение Ca 2+ из ER.

ИРБИТ и Bcl2l10 взаимодействуют

Приведенные выше результаты свидетельствуют о том, что IRBIT и Bcl2l10 могут образовывать регуляторный комплекс на IP 3 R. Следовательно, была исследована возможность взаимодействия этих двух белков. Эндогенный белок IRBIT был иммунопреципитирован из экстракта клеток HeLa, после чего было обнаружено взаимодействие этого белка с эндогенным Bcl2l10 (рис. 3А). Чтобы дополнительно охарактеризовать это взаимодействие, мы затем искали домен, в который вовлечены Bcl2l10 и IRBIT. Домен Bh5 членов семейства Bcl-2 опосредует их взаимодействие с белками вне семейства Bcl-2, такими как Raf-1 (Wang et al., 19).96), кальциневрин (Shibasaki et al., 1997) и VDAC (Shimizu et al., 2000). Совместная иммунопреципитация между мечеными FLAG полноразмерными Bcl2l10 или ∆Bh5Bcl2l10 и HA-IRBIT показала, что домен Bh5 Bcl2l10 был необходим для его взаимодействия с IRBIT, поскольку делеционный мутант ∆Bh5Bcl2l10 потерял способность связывать IRBIT (рис. 3B).

IRBIT и Bcl2l10 взаимодействуют друг с другом и принадлежат к белковому комплексу в МАМ.
г.

( A ) Вестерн-блот IP между эндогенным IRBIT и эндогенным Bcl2l10. Вестерн-блот, представитель трех независимых экспериментов. ( B ) Вестерн-блот IP между HA-IRBIT и FLAG-Bcl2l10 или FLAG-∆Bh5Bcl2l10. Вестерн-блот представитель трех независимых экспериментов. ( C ) Схематическое представление полноразмерного IRBIT и используемых делеционных мутантов. PP – сайт связывания протеинфосфатазы-1; Ser – область, богатая серином; CC — спиральный домен. ( D ) Вестерн-блот IP между FLAG-Bcl2l10 и HA-IRBIT или указанными меченными HA мутантами IRBIT. Вестерн-блот представитель трех независимых экспериментов. ( E ) Вестерн-блот IP между FLAG-Bcl2l10 и EGFP или указанными мутантами IRBIT в слиянии с EGFP. ( F ) Белковые компоненты субклеточных фракций, приготовленных из клеток HeLa, выявляемых вестерн-блоттингом. Цито – цитозоль; ЭР – эндоплазматический ретикулум; Неочищенный митохондрий – сырые митохондрии, состоящие из чистых митохондрий (Mito Pure) и митохондриально-ассоциированных мембран (MAM). Вестерн-блот представитель трех независимых экспериментов. ( G ) Сине-нативный (BN) и SDS-PAGE 2D-разделение фракции сырых митохондрий, полученной из клеток HeLa. SDS-PAGE второго измерения анализировали вестерн-блоттингом. Вестерн-блот представитель двух независимых экспериментов.

https://doi.org/10.7554/eLife.19896.004

Первые 104 аминокислоты ИРБИТ необходимы для его взаимодействия с IP 3 R (Ando et al., 2003). В частности, фосфорилирование остатков Ser71, Ser74 и Ser77 необходимо для связывания IRBIT с IP 3 R. Это множественное фосфорилирование основано на первичном фосфорилировании Ser68 (Ando et al., 2006; Devogelaere et al. , 2007). Так, делеция первых 104 аминокислот IRBIT или мутация S68A отменяет взаимодействие с IP 3 R (Ando et al., 2003, 2006). Интересно, что эти мутации не влияли на способность IRBIT ко-иммунопреципитировать с Bcl2l10 при совместной экспрессии в клетках HeLa (рис. 3D), что свидетельствует о том, что IRBIT связывает Bcl2l10 независимо от его взаимодействия с IP 9.0005 3 R. Чтобы идентифицировать область IRBIT, участвующую во взаимодействии с Bcl2l10, мы провели дополнительные эксперименты по совместной иммунопреципитации между Bcl2l10 и различными мутантами IRBIT с делецией C-конца (рис. 3C). Как и ожидалось, первые 104 аминокислоты ИРБИТ (ИРБИТ 1–104) не были способны взаимодействовать с Bcl2l10. Точно так же IRBIT 1–138, который содержит домен спиральной спирали, не взаимодействовал с Bcl2l10 (рис. 3C и E). Однако мы обнаружили слабое взаимодействие между IRBIT 1–169 и Bcl2l10, тогда как IRBIT 1–201 и 1–231 сильно взаимодействовали с Bcl2l10 (рис. 3C и E).

В совокупности эти результаты показали, что Bcl2l10 через свой домен Bh5 взаимодействует с аминокислотами 138–201 IRBIT, причем особенно важны остатки 169–201. Эта часть IRBIT сама по себе не связывает IP 3 R, что указывает на то, что взаимодействие Bcl2l10-IRBIT не зависит от связывания IRBIT с IP 3 R. Это наблюдение подтверждается тем фактом, что Bcl2l10 может взаимодействовать с нефосфорилируемым мутантом. ИРБИТ С68А.

IRBIT и Bcl2l10 совместно локализуются на мембранах ER и принадлежат к одному и тому же белковому комплексу в MAM 9.0069

Поскольку IRBIT и Bcl2l10 взаимодействуют вместе и с IP 3 R, мы затем исследовали, могут ли эти три белка связываться с образованием белкового комплекса in vivo. Сначала мы проанализировали субклеточную локализацию IRBIT и Bcl2l10, чтобы подтвердить их колокализацию. Субклеточное фракционирование, проведенное на клетках HeLa, показало, что IRBIT присутствует в цитозоле, в ER и в неочищенных митохондриях. Эта последняя фракция содержит чистые митохондрии и митохондриально-ассоциированные мембраны ER (MAM). IRBIT локализуется только в МАМ и не обнаруживается в чистых митохондриях (рис. 3F). Bcl2l10 обнаруживается в ЭР и в необработанных митохондриях. Однако, в отличие от других антиапоптотических членов семейства Bcl-2, Bcl2l10 не обнаруживался во фракции чистых митохондрий и присутствовал только в MAM (рис. 3F). Это показало, что Bcl2l10 является необычным антиапоптотическим белком, который проявляет свою функцию только в ER, что позволяет предположить, что его основной механизм действия может заключаться в регуляции Ca 9.0007 2+ сигнализация. В этом отношении MAM играют центральную роль в Ca 2+ -зависимом апоптозе, потому что именно в этом компартменте Ca 2+ непосредственно переносится из ER в митохондрии через белковый комплекс, содержащий IP 3 R и VDAC (Szabadkai et al., 2006). Затем мы исследовали, принадлежат ли Bcl2l10 и IRBIT к этому белковому комплексу, поскольку оба белка локализованы в МАМ. Для этой цели мы проанализировали сырую митохондриальную фракцию с помощью 2D-синтетического SDS-PAGE. Выполняя вестерн-блоттинг на SDS-PAGE второго измерения, мы идентифицировали белковый комплекс, который содержит IP 9. 0005 3 R, VDAC, IRBIT и Bcl2l10 (рис. 3G), что позволяет предположить, что эти белки связываются в нативном состоянии.

IRBIT и Bcl2l10 затем совместно локализовались на мембране ER и, в частности, в МАМ, где они образовывали белковый комплекс с IP 3 R и VDAC. Это предполагает, что IRBIT и Bcl2l10 могут быть ключевыми регуляторами переноса Ca 2+ между ER и митохондриями.

Дефосфорилирование IRBIT участвует в индукции апоптоза

Поскольку IRBIT взаимодействует с Bcl2l10, антиапоптотическим белком, и поскольку эти белки объединяются в комплекс в MAM, субклеточный компартмент, необходимый для Ca 2+ -зависимый апоптоз, мы исследовали, играет ли IRBIT роль в гибели клеток. Чтобы решить эту проблему, мы сравнили чувствительность к апоптозу клеток HeLa дикого типа (WT) с клетками HeLa IRBIT KO, созданными с использованием системы CRISPR/Cas9. Учитывая локализацию IRBIT и Bcl2l10, мы сосредоточились на Ca 2+ – и ER-стресс-индуцированном апоптозе. Затем клетки обрабатывали либо 1 мкМ стауроспорина (STS), мощным индуктором апоптоза, который заметно вызывает митохондриальное повышение [Ca 2+ ] (Prudent et al., 2015), либо индуктором ER-стресса туникамицином (TUN при 20 мкМ) , который также опосредует апоптоз, вызывая сильное повышение митохондриального [Ca 2+ ] (Deniaud et al., 2008). Гибель клеток оценивали по окрашиванию активной каспазой-3, и мы неожиданно обнаружили, что IRBIT KO делает клетки более устойчивыми к апоптозу (рис. 4А и рис. 4 — дополнение к рисунку 1А). Этот результат был подтвержден вестерн-блоттингом расщепленного PARP, классического признака апоптоза, который показал сниженное расщепление PARP как в клетках IRBIT KO HeLa, так и в клетках IRBIT KO MEF (рис. 4B и рис. 4 — дополнение к рисунку 1B). Экспрессия IRBIT в клетках KO восстанавливала чувствительность к апоптозу до уровня, аналогичного предполагаемому в клетках WT (рис. 4B), что позволяет предположить, что эффект IRBIT на гибель клеток, наблюдаемый здесь, является специфическим и что IRBIT необходим для апоптоза.

ИРБИТ необходим для апоптоза, во время которого он дефосфорилируется и транслоцируется из мембран ЭР.

( A ) Гистограмма, показывающая средний процент (±SEM) клеток WT или IRBIT KO HeLa, положительных на активную каспазу-3, после обработки ДМСО (1/1000 в течение 24 часов), стауроспорином (STS 1 мкМ для 4 часа) или туникамицин (Tun 20 мкМ в течение 24 часов) (n = три независимых эксперимента, анализ трех полей для каждого условия в каждом эксперименте, >200 клеток на поле). ( B ) Вестерн-блот-анализ экстрактов клеток WT HeLa, трансфицированных пустым вектором, или клеток IRBIT KO HeLa, трансфицированных пустым вектором или HA-IRBIT и обработанных ДМСО (1/1000 в течение 24 часов), стауроспорином (STS 1 мкМ в течение 4 часа) или туникамицин (Tun 20 мкМ в течение 24 часов). Количественную оценку проводили из трех независимых экспериментов. ( C ) Вестерн-блоттинг экстрактов клеток HeLa, обработанных ДМСО (1/1000 в течение 24 часов), стауроспорином (STS 1 мкМ в течение 4 часов) или туникамицином (Tun 20 мкМ в течение 24 часов). ( D ) Гистограмма, показывающая относительное фосфорилирование остатков Ser68/71 и Ser74/77 IRBIT после обработки стауроспорином (1 мкМ) или туникамицином (20 мкМ) в течение 4 часов или 24 часов соответственно. (n = три независимых эксперимента.) ( E ) Вестерн-блот экстрактов клеток HeLa, обработанных ДМСО в течение 2 часов (-) или 1 мкМ STS в течение 30, 60 или 90 минут (левая панель) или ДМСО. в течение 8 часов (-) или 20 мкМ туникамицина в течение 4, 6 или 8 часов (правая панель). ( F ) Гистограмма, показывающая относительное фосфорилирование остатков Ser68/71 и Ser74/77 IRBIT после обработки STS (1 мкМ) в течение 30 минут, 60 минут или 90 мин (левая панель) или обработка TUN (20 мкМ) в течение 4, 6 или 8 часов (правая панель). (n = три независимых эксперимента.) ( G ) Белковые компоненты субклеточных фракций, приготовленные из клеток HeLa, обработанных STS в течение 4 часов или TUN в течение 24 часов, и выявленные с помощью вестерн-блоттинга. Цито – цитозоль; МАМ – митохондриально-ассоциированные мембраны; ЭР – эндоплазматический ретикулум. *р<0,05, **р<0,01, ***р<0,001. См. также рисунок 4 — дополнение к рисунку 1.

https://doi.org/10.7554/eLife.19896.005

Активность IRBIT зависит от его статуса фосфорилирования, поскольку его взаимодействие с большинством его партнеров зависит от фосфорилирования нескольких остатков серина (Ando et al., 2014). В частности, для взаимодействия IRBIT с IP -3- R необходимо фосфорилирование остатков Ser68, Ser71, Ser74 и Ser77 (Ando et al., 2006). Поскольку IP 3 R играет центральную роль в апоптозе (Jayaraman and Marks, 1997; Szalai et al., 1999), затем мы исследовали, может ли модуляция взаимодействия IRBIT-IP 3 R объяснить участие IRBIT в гибели клеток. Чтобы ответить на этот вопрос, мы проанализировали фосфорилирование IRBIT во время апоптоза. Лизат клеток HeLa, обработанных либо 1 мкМ STS в течение 6 часов, либо 20 мкМ TUN в течение 24 часов, анализировали с помощью Вестерн-блоттинга с использованием двух антител, специфичных к фосфо-ИРБИТ (S68p/S71p и S74p/S77p) (Ando et al., 2009). Соотношение между интенсивностями полос фосфо-ИРБИТ и ИРБИТ рассчитывали и сравнивали с соотношением в контроле (обработка ДМСО) для получения относительного фосфорилирования S68/S71 и S74/77. Используя этот подход, мы определили, что после апоптоза, индуцированного стауроспорином или туникамицином, фосфорилирование IRBIT на Ser68, Ser71, Ser74 и S77 было значительно снижено (рис. 4C и D). Это говорит о том, что функция ИРБИТ и особенно его влияние на IP 3 Р, может изменяться во время апоптоза. Этот результат также поднимает вопрос о том, является ли дефосфорилирование IRBIT ранним событием, которое может участвовать в индукции апоптоза, или оно является просто следствием гибели клеток. Затем мы проанализировали фосфорилирование IRBIT после короткой обработки STS (0,5, 1 или 1,5 часа) или TUN (4, 6 или 8 часов). В это время инкубации апоптоз не был достигнут, о чем свидетельствует отсутствие расщепленного PARP (рис. 4E). Однако уже через 30 минут после обработки STS или через 4 часа после обработки TUN фосфорилирование Ser68, Ser71, Ser74 и Ser77 уже было значительно снижено (рис. 4E и F), что позволяет предположить, что дефосфорилирование IRBIT может фактически участвовать в индукции апоптоз.

Далее мы предположили, что дефосфорилирование ИРБИТ, происходящее при апоптозе, может снижать его взаимодействие с IP 3 R, после чего изменяется субклеточная локализация ИРБИТ. Мы проанализировали субклеточную локализацию IRBIT, а также Bcl2l10 после индукции апоптоза 1 мкМ стауроспорина в течение 4 часов или 20 мкМ туникамицина в течение 24 часов. Как и ожидалось, в клетках, обработанных этими препаратами, локализация IRBIT в ER и MAM была значительно снижена, тогда как общая экспрессия IRBIT была постоянной (рис. 4G). Мы не смогли обнаружить повышенное количество цитозольного IRBIT, вероятно, потому, что IRBIT в основном является цитозольным белком (Ando et al. , 2015), и поскольку количество белка, вытесненного из мембран ER, недостаточно для заметного изменения количества IRBIT в цитозоле. . Интересно, что мы определили, что вытеснение IRBIT из ER и MAM коррелирует со снижением Bcl2l10 в этих компартментах, особенно в MAM, и с повышением Bcl2l10 в цитозоле (рис. 4G).

Поскольку нефосфорилированный IRBIT взаимодействует с Bcl2l10 (рис. 3D), но не с IP 3 R, эти результаты позволяют предположить, что после его дефосфорилирования в начале апоптоза нефосфорилированный IRBIT может удалять Bcl2l10 с мембран ER и вытеснять его в цитозоль. Удаление IRBIT и Bcl2l10 из MAM может, следовательно, способствовать проапоптотическому переносу Ca 2+ в митохондрии, тем самым объясняя, как IRBIT может способствовать гибели клеток.

ИРБИТ КО устраняет действие препаратов, индуцирующих апоптоз, на Ca

2+ сигнализация

Чтобы подтвердить эту гипотезу, мы исследовали, действительно ли апоптотические стрессы способствуют переносу Ca 2+ из ER в митохондрии и участвует ли IRBIT в этом процессе. Сначала клетки HeLa обрабатывали в течение короткого периода либо 1 мкМ STS (30 мин), либо 20 мкМ TUN (4 часа), а затем анализировали их IICR (индуцированный 1 мкМ АТФ). В этот ранний момент времени IRBIT дефосфорилирован, но апоптоз еще не произошел (рис. 4Е). В соответствии с предыдущим исследованием (Li et al., 2009 г.), обработка STS и TUN клеток WT значительно увеличивала количество Ca 2+ , высвобождаемого через IP 3 R (фиг. 5A и B). Лечение STS также слегка увеличивало базальную цитозольную концентрацию Ca 2+ , но это не может объяснить влияние препарата на IICR. Как и ожидалось, в контрольных условиях (ДМСО) клетки IRBIT KO имели повышенный IICR по сравнению с клетками WT. Однако в клетках ИРБИТ КО эффект STS и TUN на высвобождение Ca 2+ из ER был сильно ослаблен; в этих клетках STS оказывал лишь незначительное влияние на IICR, тогда как TUN существенно не модифицировал его (рис. 5A-C). Эти результаты показывают, что стрессы, индуцирующие апоптоз, увеличивают высвобождение Ca 2+ через IP 3 R, и ключевую роль в этом процессе играет ИРБИТ.

ИРБИТ КО устраняет действие препаратов, индуцирующих апоптоз, на передачу сигналов Ca
2+ .

( A ) Репрезентативная кривая ответа Ca 2+ клеток HeLa, нагруженных Fura-2, стимулированных 1 мкМ АТФ в указанные моменты времени. Клетки WT (левая панель) или IRBIT KO (правая панель) обрабатывали либо ДМСО (1/1000) в течение 4 часов, 1 мкМ STS в течение 30 минут или 20 мкМ TUN в течение 4 часов перед визуализацией. Базал Фура-2 Ф 340 нм /F 380 нм = 0,76 ± 0,01, 0,79 ± 0,01 и 0,75 ± 0,01 для клеток дикого типа, обработанных ДМСО, STS и TUN, соответственно; базальный Fura-2 F 340 нм /F 380 нм = 0,75 ± 0,01, 0,78 ± 0,01 и 0,74 ± 0,01 для клеток ИРБИТ KO, обработанных ДМСО, STS и TUN, соответственно. ( B ) Гистограмма, показывающая среднюю амплитуду (±SEM) АТФ-индуцированного пика Ca 2+ (n: количество клеток, проанализированных в трех независимых экспериментах). ( C ) Гистограмма, показывающая среднюю относительную амплитуду (±SEM) АТФ-индуцированного Ca 2+ пик в клетках, обработанных указанными препаратами, по сравнению с контролем (ДМСО). ( D ) Репрезентативные изображения клеток HeLa, нагруженных Rhod-2, обработанных либо ДМСО (1/1000) в течение 8 часов, STS 1 мкМ в течение 90 минут или TUN 20 мкМ в течение 8 часов. ( E ) Гистограмма, показывающая среднюю относительную интенсивность флуоресценции Rhod-2 (±SEM) клеток HeLa, обработанных указанными препаратами, по сравнению с контролем (ДМСО). (n: количество клеток, проанализированных в трех независимых экспериментах.) *p<0,05, **p<0,01, ***p<0,001.

https://doi.org/10.7554/eLife.19896.007

Затем мы исследовали, коррелирует ли это связанное со стрессом повышенное высвобождение Ca 2+ из ER с повышением митохондриального [Ca 2+ ], явлением, которое, как известно, запускает апоптоз (Giorgi et al. , 2009) . Для этого клетки HeLa нагружали митохондриальным красителем Ca 2+ Rhod-2 и обрабатывали либо 1 мкМ STS в течение 90 мин или 20 мкМ TUN в течение 8 часов. Как показано на фиг. 5D и E, обработка STS и TUN индуцировала в клетках HeLa WT сильное повышение уровня митохондрий [Ca 2+ ], которое было значительно снижено в клетках IRBIT KO. Это предполагает, что после обработки STS и TUN повышенное высвобождение Ca 2+ из ER может передаваться в митохондрии, что приводит к апоптозу. IRBIT кажется необходимым для того, чтобы это произошло, поскольку IRBIT KO предотвращает как повышенное высвобождение Ca 2+ , так и повышение уровня митохондриального [Ca 2+ ].

В совокупности эти результаты подтверждают идею о том, что IRBIT участвует в гибели клеток, способствуя переносу Ca 2+ из ER в митохондрии. Дефосфорилирование IRBIT в начале апоптоза может объяснить эту функцию IRBIT, поскольку оно может привести к удалению Bcl2l10 из мембран ER.

Нефосфорилированный IRBIT ингибирует функцию Bcl2l10 в ER

Чтобы подтвердить эту модель, мы затем изучили влияние дефосфорилирования IRBIT на Bcl2l10, исследуя влияние нефосфорилированного IRBIT на функцию Bcl2l10. Сначала мы исследовали взаимодействие Bcl2l10 с IP 9.0005 3 Р при наличии или отсутствии нефосфорилированного ИРБИТ. Для этой цели экстракты клеток HeLa, экспрессирующих Bcl2l10 и IRBIT S68A по отдельности или в комбинации, подвергали GST-pulldown с рекомбинантным GST-IP 3 R∆CD. Как и ожидалось, IRBIT S68A не взаимодействовал с IP 3 R, тогда как Bcl2l10 взаимодействовал. Однако коэкспрессия IRBIT S68A заметно снижала взаимодействие Bcl2l10 с IP 3 R (фиг. 6А). Чтобы подтвердить этот результат, был проведен анализ GST-pulldown с использованием рекомбинантного GST-IP 9.0005 3 BD инкубировали с рекомбинантным Bcl2l10 в сочетании с фосфорилированным рекомбинантным IRBIT (продуцируемым в клетках Sf9) и/или с нефосфорилированным рекомбинантным IRBIT (продуцируемым в Escherichia coli ) (Ando et al. , 2006). В присутствии фосфорилированного IRBIT Bcl2l10 прочно связывался с GST-IP 3 BD, тогда как в присутствии нефосфорилированного IRBIT это взаимодействие было значительно слабее (рис. 6B). Более того, хотя ранее мы обнаружили, что фосфорилированный IRBIT способствует взаимодействию Bcl2l10 с IP 3 BD (рис. 2D), этот эффект исчезал в присутствии нефосфорилированного ИРБИТ. Действительно, взаимодействие между Bcl2l10 и IP 3 BD в присутствии нефосфорилированного IRBIT было сходным независимо от того, присутствовал ли фосфорилированный IRBIT (фиг. 6B). Это свидетельствует о том, что нефосфорилированный IRBIT ингибирует взаимодействие Bcl2l10 с IP 3 R и что дефосфорилирование IRBIT во время апоптоза может способствовать вытеснению Bcl2l10 из мембран ER.

Нефосфорилированный ИРБИТ ингибирует активность Bcl2110.

( A ) Вестерн-блот GST-pulldown, выполненный с GST-IP 3 RΔCD на лизатах клеток HeLa, экспрессирующих HA-IRBIT S68A и FLAG-Bcl2l10 по отдельности или в комбинации. Количественную оценку проводили из трех независимых экспериментов. ( B ) Вестерн-блоттинг GST-pulldown, выполненный с помощью GST-IP 3 BD на рекомбинантном Bcl2l10 в сочетании с рекомбинантным IRBIT, полученным в Sf9клеток или в E. coli . Количественную оценку проводили из трех независимых экспериментов. ( C ) Репрезентативная кривая ответа Ca 2+ клеток IRBIT KO MEF, нагруженных Fura-2, стимулированных 1 мкМ АТФ в указанные моменты времени. Клетки трансфицировали пустым вектором или плазмидой, экспрессирующей FLAG-Bcl2110 и FLAG-IRBIT S68A по отдельности или вместе. ( D ) Гистограмма, показывающая среднюю амплитуду (±SEM) АТФ-индуцированного пика Ca 2+ (n: число клеток, проанализированных в трех независимых экспериментах). ( E ) Репрезентативная кривая ответа Ca 2+ клеток IRBIT KO HeLa, нагруженных Fura-2, стимулированных 1 мкМ АТФ в указанные моменты времени. Клетки трансфицировали пустым вектором или плазмидой, экспрессирующей FLAG-IRBIT S68A, или контрольной миРНК, или миРНК против Bcl2110. ( F ) Гистограмма, показывающая среднюю амплитуду (±SEM) АТФ-индуцированного пика Ca 2+ (n: число клеток, проанализированных в трех независимых экспериментах). ( G ) Гистограмма, показывающая средний процент (±SEM) клеток HeLa, экспрессирующих FLAG-Bcl2l10 и FLAG-IRBIT S68A отдельно или в комбинации и положительных на окрашивание активной каспазы-3 после обработки ДМСО (1/1000 для 24 ч), туникамицин (TUN; 20 мкМ в течение 24 часов) или стауроспорин (STS; 1 мкМ в течение 4 часов) (n = 3 независимых эксперимента, анализ трех полей для каждого условия в каждом эксперименте, > 200 клеток на поле). *р<0,05, **р<0,01, ***р<0,001. См. также рисунок 6 — дополнение к рисунку 1.

https://doi.org/10.7554/eLife.19896.008

Для дальнейшего подтверждения нашей гипотезы мы оценили влияние нефосфорилированного IRBIT на способность Bcl2l10 снижать высвобождение Ca 2+ через IP 3 R. Как и ожидалось, Bcl2l10 сам по себе значительно снижал IICR после обработки 1 мкМ АТФ, тогда как IRBIT S68A сам по себе не влиял на IICR (рис. 6C и D и рис. 6 — дополнение к рисунку 1A). Однако, когда эти два белка коэкспрессировались, мы обнаружили, что Bcl2l10 утратил свой эффект на IICR, так как Ca 9Пик 0007 2+ был аналогичен пику, наблюдаемому в отсутствие Bcl2l10 (рис. 6C и D). Поскольку IRBIT S68A может вытеснять эндогенный Bcl2l10 из мембран ER, тот факт, что его сверхэкспрессия сама по себе не влияет на IICR, был неожиданным. Одной из причин может быть то, что в используемых условиях количество Ca 2+ , высвобождаемое из ER, было высоким и маскировало эффект удаления Bcl2l10 из мембран ER. Затем мы сверхэкспрессировали IRBIT S68A в клетках HeLa IRBIT KO, которые демонстрируют более слабое высвобождение Ca 2+ после обработки 1 мкМ АТФ. В этих условиях экспрессия IRBIT S68A увеличивала IICR в той же степени, что и нокдаун Bcl2l10, в то время как базальный цитозольный Ca 2+ не пострадал (рис. 6E, F и рис. 6 — дополнение к рисунку 1B). Нокдаун Bcl2l10 с использованием siRNA был подтвержден вестерн-блоттингом (рис. 6 — дополнение к рисунку 1B). Эти результаты подтверждают идею о том, что дефосфорилирование IRBIT может оказывать ингибирующее действие на Bcl2l10.

Наконец, мы исследовали, влияет ли нефосфорилированный IRBIT на антиапоптотическую функцию Bcl2l10. Клетки HeLa, экспрессирующие Bcl2l10 отдельно или в комбинации с IRBIT S68A, обрабатывали 1 мкМ стауроспорина в течение 6 часов или 20 мкМ туникамицина в течение 24 часов, а гибель клеток оценивали путем окрашивания активной каспазы-3. Сверхэкспрессия Bcl2l10 снижает гибель клеток, поскольку это антиапоптотический белок. Однако, в соответствии с нашими предыдущими результатами, Bcl2l10 больше не был способен защищать клетки от апоптоза при совместной экспрессии с IRBIT S68A (рис. 6G и рис. 6 — дополнение к рисунку 1), что позволяет предположить, что нефосфорилированный IRBIT действует как ингибитор Bcl2l10.

Следовательно, все эти результаты сильно подкрепляют нашу модель, в которой дефосфорилирование IRBIT во время инициации апоптоза способствует вытеснению Bcl2l10 из мембран ER путем ингибирования взаимодействия Bcl2l10 с IP 3 R. Как следствие, как показывают наши результаты, Bcl2l10 больше не может регулировать высвобождение Ca 2+ из ER и проявлять свою антиапоптотическую активность.

ИРБИТ способствует переносу ER-митохондрий Ca

2+ и образованию точек контакта

Наши результаты показывают, что во время апоптоза IRBIT может способствовать переносу Ca 2+ между ER и митохондриями в патикулярном путем ингибирования Bcl2l10. Этот механизм должен особенно проявляться в МАМ, поскольку IRBIT и Bcl2l10 удаляются из этого компартмента, где обычно генерируются проапоптотические сигналы Ca 2+ , направленные на митохондрии (Giorgi et al., 2009), во время апоптоза. Чтобы дополнительно расшифровать роль IRBIT в MAM, мы затем изучили, в какой степени этот белок может влиять на Ca 9.Поток 0007 2+ между ER и митохондриями путем сравнения переноса ER-митохондрий Ca 2+ между клетками WT и IRBIT KO MEF. В этих экспериментах клетки обрабатывали 20 мкМ АТФ, чтобы вызвать массовое высвобождение Ca 2+ из ER, перенос которого в митохондрии можно легко обнаружить. В этих условиях, как показало измерение цитозольных уровней Ca 2+ с помощью Fura-2, высвобождение Ca 2+ из ER было выше в клетках IRBIT KO, чем в клетках WT (Фигура 7A и Рисунок 7 – дополнение к рисунку 1А), что согласуется с ранее описанным влиянием ИРБИТ на ИИКР. Однако измерение митохондриального Ca 2+ с митохондриальным красителем Са 2+ Rhod-2 показал, что, хотя ИИКР был повышен в клетках ИРБИТ КО, количество Са 2+ , накопленное в митохондриях этих клеток, было ниже по сравнению с таковым в клетках ИРБИТ КО. Клетки WT (рис. 7B). Этот результат показывает, что перенос Ca 2+ между ER и митохондриями нарушен в клетках IRBIT KO.

IRBIT продвигает ER-митохондрии Ca
2+ передача и контакт.

( A ) Левая панель: репрезентативная кривая ответа Ca 2+ клеток WT или IRBIT KO MEF, нагруженных Fura-2, стимулированных 20 мкМ АТФ в указанные моменты времени. Правая панель: Гистограмма, показывающая среднюю амплитуду (±SEM) АТФ-индуцированного пика Ca 2+ (n: число клеток, проанализированных в трех независимых экспериментах). ( B ) Левая панель: репрезентативный ответ Ca 2+ в митохондриях Rhod-2-нагруженных клеток WT или IRBIT KO MEF, стимулированных 20 мкМ в указанные моменты времени. Правая панель: гистограмма, показывающая среднюю амплитуду (±SEM) АТФ-индуцированного Ca 2+ пик в митохондриях (n: количество клеток, проанализированных в трех независимых экспериментах). ( C ) Репрезентативные электронные микроскопические изображения клеток WT и IRBIT KO HeLa. Красные стрелки указывают точки контакта между ЭР и митохондриями. Красные двунаправленные стрелки указывают длину контакта ER-митохондрий (L) и расстояние между ER и митохондриями (d). ( D ) Количественный анализ контактов ER-митохондрий, наблюдаемых с помощью электронной микроскопии в клетках WT и IRBIT KO HeLa. Гистограммы показывают процент митохондрий, контактирующих с ER (n = три клетки, проанализированные на одно условие. WT – 91 митохондрия, ИРБИТ КО – 85 митохондрий), средняя длина (±SEM) контакта ЭР с митохондриями, среднее расстояние (±SEM) между ЭР и митохондриями в точках контакта и процент точек контакта ЭР с митохондриями, измеряющих указанную длину (n = проанализировано три клетки на условие; WT – 48 митохондрий, ИРБИТ КО – 27 митохондрий). ( E ) Левая панель: иммунофлуоресценция клеток WT и IRBIT KO HeLa, трансфицированных маркером ER (KDEL-GFP (зеленый)) и окрашенных антителом против TOM20 (пурпурный) для мечения митохондрий. Клетки WT также трансфицировали пустым вектором, а клетки IRBIT KO – пустым вектором или вектором, экспрессирующим FLAG-IRBIT или FLAG-IRBIT S68A. Области, показанные крупным планом, выделены местами контактов ER-митохондрий. Правая панель: гистограмма, показывающая средний коэффициент перекрытия Мандера (±SEM) и средний коэффициент Пирсона (±SEM) клеток WT и IRBIT KO, экспрессирующих указанный белок (n = три независимых эксперимента, ~ 20 клеток, проанализированных на условие для каждого эксперимента ). *р<0,05, **р<0,01, ***р<0,001. См. также рисунок 7 — дополнение к рисунку 1.

https://doi.org/10.7554/eLife.19896.010

ER в митохондрии Ca 2+ перенос происходит на уровне МАМ (Giorgi et al., 2009). Затем мы изучили состояние контакта ER-митохондрий в клетках IRBIT KO HeLa с помощью электронной микроскопии (рис. 7C и D). Этот анализ показал, что в клетках IRBIT KO процент митохондрий, контактирующих с ER, был меньше, чем в клетках WT. Более того, хотя среднее расстояние между ЭР и митохондриями в точках контакта было одинаковым в клетках WT и IRBIT KO, средняя длина точек контакта была значительно меньше в клетках IRBIT KO. Соответственно, в клетках ИРБИТ КО контактные точки длиной более 600 нм практически не встречались, а менее 200 нм встречались часто. Напротив, в клетках WT контактные точки короче 200 нм обнаруживались редко, а длиннее 600 нм встречались часто (рис. 7D). Эти результаты предполагают, что IRBIT может участвовать в формировании или стабилизации точек контакта ER-митохондрий. Чтобы дополнительно подтвердить это наблюдение, мы окрасили ER и митохондрии клеток HeLa и MEF и оценили колокализацию между двумя органеллами, используя коэффициент перекрытия Мандера и коэффициент Пирсона (Bolte and Cordelières, 2006). Как и ожидалось, в клетках HeLa IRBIT KO и в клетках MEF IRBIT KO колокализация между ER и митохондриями была снижена по сравнению с таковой в клетках WT (рис. 7E и рис. 7 — дополнение к рисунку 1B). Экспрессия IRBIT в клетках IRBIT KO увеличивала коэффициенты колокализации до уровней, сходных с уровнями клеток WT (рис. 7E). Эти результаты подтверждают идею о том, что IRBIT участвует в формировании или стабилизации точек контакта ER-митохондрий. Как ИП 3 R является ключевым компонентом MAM, и поскольку ИРБИТ взаимодействует с ним, мы затем рассмотрели, может ли это взаимодействие объяснять роль ИРБИТ в контактных точках. Интересно, что экспрессия IRBIT S68A (который не может связывать IP 3 R) в клетках IRBIT KO не восстанавливала контакт ER-митохондрий (рис. 7E), что позволяет предположить, что взаимодействие между IRBIT и IP 3 R может участвовать в формировании контактных точек.

В совокупности эти результаты привели нас к созданию модели, описанной ниже (рис. 8). IRBIT способствует контактным точкам ER-митохондрий, тем самым облегчая Ca 2+ перенос в митохондрии. В отсутствие стресса это уравновешивается взаимодействием между IRBIT и Bcl2l10, которое контролирует количество Ca 2+ , высвобождаемого через IP 3 R, и обеспечивает правильный трафик Ca 2+ между ER и митохондриями. Однако в условиях стресса дефосфорилирование IRBIT вызывает вытеснение как этого белка, так и Bcl2l10 из мембран ER. Эта транслокация, вероятно, способствует проапоптотическому переносу Ca 2+ из ER в митохондрии, чему способствует непосредственная близость между органеллами, стимулируемая IRBIT. Напротив, в клетках IRBIT KO отсутствие IRBIT приводит к уменьшению контакта ER-митохондрий; Bcl2l10 также может быть более обильным в МАМ и больше не смещаться во время апоптоза. Это может избежать проапоптотического Ca 2+ перенос между ЭР и митохондриями, что объясняет устойчивость этих клеток к апоптозу.

Схематическая модель, изображающая роль взаимодействия IRBIT-Bcl2l10 в физиологических и стрессовых условиях.

В физиологических условиях в клетках WT IRBIT способствует контакту ER-митохондрий, что облегчает перенос Ca 2+ между двумя органеллами. Аддитивный эффект Bcl2l10 и фосфорилированного ИРБИТ на IP 3 R поддерживает перенос Ca 2+ на низком уровне. В клетках IRBIT KO количество Ca 2+ , которое высвобождается через IP 3 R, увеличивается из-за отсутствия IRBIT, но перенос Ca 2+ в митохондрии снижается из-за значительного снижения ER- контакт митохондрий. После апоптотических стимулов высвобождение Ca 2+ из ER увеличивается. В клетках дикого типа дефосфорилирование IRBIT индуцирует его транслокацию в цитозоль вместе с Bcl2l10, что делает возможным массивное накопление Ca 2+ перенос из ЭР в митохондрии. Напротив, в клетках IRBIT KO Bcl2l10 больше не вытесняется из MAM, уменьшая высвобождение Ca 2+ из ER. Это, в сочетании с уменьшением контакта ER-митохондрий, предотвращает массовый перенос Ca 2+ в митохондрии и, таким образом, значительно ослабляет апоптоз.

https://doi.org/10.7554/eLife.19896.012

Обсуждение

В настоящем исследовании мы продемонстрировали взаимодействие между IRBIT и гомологом Bcl-2, Bcl2l10. Эти два белка взаимодействуют с одним и тем же доменом IP 3 R; но в то время как IRBIT взаимодействует с карманом связывания IP 3 (Ando et al. , 2006), было показано, что Nrz, ортолог Bcl2l10 рыбок данио, взаимодействует с различными остатками (Bonneau et al., 2014). Наши результаты подтверждают, что IRBIT и Bcl2l10 имеют разные сайты связывания в IP 3 -связывающий домен и демонстрируют наличие комплекса Bcl2l10-IRBIT на IP 3 R. Домен Bh5 Bcl2l10 участвует во взаимодействии с IRBIT и IP 3 R, но две отдельные части IRBIT опосредуют взаимодействия. с Bcl2l10 и IP 3 R. IP 3 BD структурирован как щель, в конце которой находится карман для связывания IP 3  (Bosanac et al., 2002). N-концевая часть ИРБИТ (остатки 1–104), вероятно, скрыта в IP 9.0005 3 BD в месте взаимодействия с IP 3 – карман для привязки. Мы предполагаем, что остальная часть белка выступает за пределы расщелины, где расположен Bcl2l10. Это позволяет остаткам 169–201 IRBIT связываться с доменом Bh5 Bcl2l10, который структурирован в виде α-спирали; следовательно, можно предположить, что одна сторона спирали взаимодействует с IP 3 R, а другая – с ИРБИТ. Эта ассоциация между IRBIT и Bcl2l10 может стабилизировать их взаимодействие с IP 9.0005 3 Р, что усиливает их влияние на ИИКР.

Дефосфорилирование IRBIT в начале апоптоза, по-видимому, активно участвует в осуществлении гибели клеток. IRBIT обладает сайтом связывания протеинфосфатазы-1 (PP1) перед его богатой серином областью (рис. 3В), между остатками 40 и 44 (Devogelaere et al., 2007). Было показано, что этот сайт связывания дефосфорилирует остаток Ser68, но не остатки Ser71, Ser74 и Ser 77 (Devogelaere et al., 2007). Интересно, что было показано, что PP1 опосредует апоптоз посредством дефосфорилирования Akt (Thayyullathil et al., 2011) и pRb (Puntoni and Villa-Moruzzi, 19).99; Ван и др., 2001). Более того, PP1 может дефосфорилировать и активировать Bh4-only белок Bad, чтобы индуцировать апоптоз (Ayllón et al., 2000). Наконец, сообщалось, что ингибирование PP1 защищает кардиомиоциты от индуцированного туникамицином апоптоза (Liu et al., 2014). Все эти исследования подчеркнули роль PP1 в индукции апоптоза, и мы можем предположить, что IRBIT является мишенью PP1 в начале апоптоза. Однако, хотя дефосфорилирование Ser68 с помощью PP1 может предотвращать дальнейшее фосфорилирование Ser71, Ser74 и Ser77, маловероятно, что PP1 сам по себе объясняет дефосфорилирование этих остатков, наблюдаемое во время апоптоза. Анализ последовательности IRBIT выявил наличие мотива LxVP между остатками 271 и 274, который является сайтом связывания Ca 2+ /кальмодулинзависимая фосфатаза, кальцинейрин (Rodríguez et al., 2009; Slupe et al., 2013). Кальцинейрин играет роль в апоптозе; в частности, он участвует в Ca 2+ -зависимом апоптозе, активируя Bh4-только белок Bad (Wang et al., 1999) и способствуя транслокации Drp-1 в митохондрии (Ceregetti et al. ., 2008, 2010). Необходимо провести дальнейшие эксперименты для изучения способности кальциневрина дефосфорилировать IRBIT, но вполне вероятно, что совместное действие PP1 и кальциневрина отвечает за дефосфорилирование IRBIT во время апоптоза.

Во время апоптоза IRBIT, по-видимому, действует путем вытеснения Bcl2l10 из мембран ER, тем самым ингибируя его антиапоптозную функцию. Однако, учитывая, что IRBIT взаимодействует со многими другими партнерами, мы не можем исключить вклад одного из этих взаимодействий в апоптоз. В частности, взаимодействие ИРБИТ с Ca 2+ /кальмодулин-зависимой киназой IIα (CamKIIα) также может играть роль в апоптозе. Действительно, было показано, что IRBIT ингибирует CamKIIα (Kawaai et al., 2015), который обладает эффектом выживания, поскольку заметно способствует экспрессии Bcl-2 и ингибирует активность каспазы-2 (Nutt et al., 2005; Song et al. ., 2010; Wei et al., 2013). В связи с этим сообщалось, что ингибирование CamKII способствует апоптозу (Ma et al., 2009).; Вэй и др., 2015). Интересно, что для Bcl2l10 взаимодействие между CamKII и IRBIT не зависит от фосфорилирования IRBIT (Kawaai et al., 2015). Таким образом, в дополнение к своему действию на Bcl2l10, дефосфорилирование IRBIT во время апоптоза может способствовать его взаимодействию с CamKII, поскольку он больше не может взаимодействовать с большинством других своих партнеров. Повышенное взаимодействие IRBIT с CamKII может привести к ингибированию CamKII и, таким образом, к стимуляции апоптоза.

ИРБИТ, по-видимому, участвует в формировании или стабилизации точек контакта между ЭР и митохондриями. На сегодняшний день механизмы, регулирующие формирование этих структур, остаются в значительной степени неизвестными. Наши результаты показывают, что взаимодействие между ИРБИТ и ИС 3 R может опосредовать эффект IRBIT на контакт ER-митохондрий (рис. 7D). Этот результат был весьма неожиданным, так как IP 3 R, по-видимому, не требуется для контакта ER-митохондрий. Действительно, сообщалось, что KO трех изоформ IP 3 R в клетках DT40 не влияет на частоту и длину точек контакта (Csordás et al., 2006). Митофузин 2 (Mfn2), ГТФаза, участвующая в слиянии митохондрий, признан ключевым игроком в установлении контакта ER-митохондрий, поскольку сообщалось, что его нокаут сильно влияет как на формирование MAM, так и на Ca 9.0007 2+ перенос между двумя органеллами (de Brito and Scorrano, 2008). Однако это требование Mfn2 в настоящее время пересматривается, поскольку два независимых исследования пришли к выводу, что нокаут Mfn2 фактически увеличивает контакт между ER и митохондриями (Cosson et al., 2012; Filadi et al., 2015). В свете этого противоречия мы не можем полностью исключить возможность того, что роль IP 3 R в формировании МАМ была упущена, в частности, если принять во внимание тот факт, что IP 3 R вместе с Grp75 и VDAC является частью комплекса, который физически связывает ER и митохондрии (Szabadkai et al., 2006). Весьма вероятно, что этот комплекс такой же, как комплекс, содержащий IRBIT и Bcl2l10 (рис. 3G). Хотя нокдаун Grp75 изменял перенос Ca 2+ между ER и митохондриями, роль комплекса IP 3 R-VDAC в контакте ER-митохондрий не была четко исследована (Szabadkai et al., 2006). Дополнительные эксперименты для переоценки роли этого комплекса и IP 3 R в формировании MAM может способствовать дальнейшему пониманию того, как IRBIT участвует в контакте ER-митохондрий. Дополнительная возможность заключается в том, что ИРБИТ взаимодействует с разными партнерами по МАМ. Действительно, многочисленные белки, такие как комплекс Fis1-Bap31 (Iwasawa et al., 2011), PERK (Verfaillie et al., 2012), комплекс VAPB-PTPIP51 (Stoica et al., 2014) и Drp-1 ( Prudent et al., 2015) локализуются в MAM и регулируют контакт ER-митохондрий. Затем IRBIT может ассоциироваться с некоторыми из этих белков, образуя связывающий комплекс между ER и митохондриями.

Тот факт, что IRBIT S68A не способствует контакту ER-митохондрий (рис. 7E), поднимает вопрос о влиянии дефосфорилирования IRBIT на стабильность точки контакта во время апоптоза. Действительно, можно предположить, что удаление IRBIT из MAM во время апоптоза может фенокопировать IRBIT KO и уменьшать контакт ER-митохондрий, тем самым уменьшая перенос Ca 2+ в митохондрии вместо его увеличения. Однако несколько исследований показали, что контакты ER-митохондрий увеличиваются во время апоптоза (Csordás et al. , 2006; Verfaillie et al., 2012; Prudent et al., 2015). В частности, Drp-1 рекрутируется в контактных точках ER-митохондрий во время апоптоза (Prudent et al., 2015), и PERK также может рекрутироваться, поскольку его KO отменяет увеличение точек контакта ER-митохондрий во время апоптоза (Verfaillie et al., 2012). Таким образом, наша гипотеза состоит в том, что перед апоптозом фосфорилированный IRBIT способствует контакту ER-митохондрий и, таким образом, создает платформу для правильного апоптоза. После индукции апоптоза IRBIT дефосфорилируется и перемещается в цитозоль, но другие белки, такие как Drp-1 или PERK, также привлекаются к MAM для усиления контакта ER-митохондрий, а затем компенсируют удаление IRBIT. В клетках IRBIT KO эти белки, вероятно, все еще рекрутируются, но поскольку контакты ER-митохондрий меньше, увеличение этих контактов недостаточно для обеспечения проапоптотического Ca 9.0007 2+ перевод.

Наше настоящее исследование выявило новую функцию IRBIT как регулятора гибели клеток благодаря его способности регулировать контакт ER-митохондрий и активность Bcl2l10. Интересно, что экспрессия IRBIT была снижена в линии клеток рака яичников человека (Jeong et al., 2012). Поскольку Bcl2l10 сильно экспрессируется в яичниках (Guillemin et al., 2009; Inohara et al., 1998), мы можем предположить, что снижение экспрессии IRBIT в клеточной линии рака яичников приводит к повышению активности Bcl2l10, что может способствовать к обычной устойчивости раковых клеток к апоптозу. Кроме того, недавно было показано, что IRBIT ингибирует рибонуклеотидредуктазу (RNR), фермент, который обеспечивает пул dNTP для репликации ДНК (Arnaoutov and Dasso, 2014). В раковых клетках высокая активность RNR необходима для снабжения dNTP, необходимых для быстрой пролиферации клеток, и при раке часто наблюдается повышенная активность RNR (Aye et al., 2015). Таким образом, сниженная экспрессия IRBIT может способствовать устойчивости к апоптозу из-за повышенной активности Bcl2l10 и уменьшенного контакта ER-митохондрий, а также дополнительно к пролиферации клеток за счет повышения активности RNR. Эти наблюдения, связанные с тем фактом, что экспрессия IRBIT была снижена в линиях раковых клеток, устойчивых к препаратам, повреждающим ДНК (Wittig et al., 2002), подчеркивают ключевую роль IRBIT в онкогенезе и могут привести к новое определение ИРБИТ как опухолевого супрессора.

Материалы и методы

Плазмидная конструкция

Запросить подробный протокол

Последовательности, кодирующие Bcl2l10 и ∆Bh5Bcl2l10, были амплифицированы из pSG5-FLAG-Bcl2l10, подарка G. Gillet (Aouacheria et al., 2001). Их клонировали между сайтами рестрикции BamHI и EcoRI вектора pCDNA3 (Invitrogen), содержащего кодирующую последовательность FLAG-tag между сайтами рестрикции HindIII и BamHI. Последовательность, кодирующую Bcl2l10∆TM, амплифицировали из pCDNA3-FLAG-Bcl2l10 и клонировали между сайтами рестрикции NdeI и HindIII бактериального вектора экспрессии pET-23a(+) (Novagen).

Векторное кодирование для KDEL-GFP описано ранее (Bannai et al., 2004). Вектор экспрессии, кодирующий HA-IRBIT, HA-IRBIT S68A, был описан ранее (Ando et al. , 2006). Делеционные мутанты IRBIT были созданы путем субклонирования укороченных фрагментов кДНК IRBIT между сайтами рестрикции HindIII и KpnI вектора pHM6 (Boehringer Mannheim) или между сайтами рестрикции HindIII и BamHI вектора pEGFPC1 (Clontech). Двунаправленный вектор pBI-CMV1 (Clontech), содержащий две MCS под контролем двух разных промоторов CMV, модифицировали для получения pBI-CMEF путем замены второго промотора CMV промотором EF1α. Последовательности, кодирующие FLAG-Bcl2l10, FLAG-IRBIT и FLAG-IRBIT S68A, амплифицировали из pCDNA3-FLAG-Bcl2l10, pCDNA3-FLAG-IRBIT и pCDNA3-FLAG-IRBIT S68A (Ando et al., 2006) и клонировали в pBI- CMEF. FLAG-Bcl2l10 клонировали под контролем промотора EF1α в MCS2 между сайтами рестрикции EcoRI и XbaI. FLAG-IRBIT и FLAG-IRBIT S68A были клонированы под контролем промотора CMV в MCS1 между сайтами рестрикции ClaI и EcoRV.

Антитела

Кроличьи антифосфо-IRBIT Ser68p/Ser71p и кроличьи антифосфо-IRBIT Ser74p/Ser77p Ab (Ando et al. , 2009), кроличьи анти-IP 3 Rs (KM1112 для IP 3 R1, KM1083 для IP 3 2 Rs и KM1082 для IP 3 R3) (Kawaai et al., 2009) и кроличье антитело против IRBIT (Ando et al., 2003) были описаны ранее. Использовали следующие антитела: крысиные антитела к HA (3F10, Roche, RRID:AB_3), мышиные антитела к β-актину (AC-15, Sigma, RRID:AB_476744), мышиные антитела к Flag (M2, F3165, Сигма, RRID: AB_259529), кроличье антитело к флагу (PA1-984B, Thermofisher, RRID:AB_347227), мышиное антитело к GFP (B-2, Santa Cruz Biotechnology Inc, RRID:AB_627695), кроличье антитело к цитохрому c (H-104 , sc-7159, Santa Cruz Biotechnology Inc, RRID:AB_20), кроличьи антитела к Tom20 (FL-145, sc-11415, Santa Cruz Biotechnology Inc, RRID:AB_2207533), мышиные антитела к AHCYL1/2 (D-7 , sc-271581, Santa Cruz Biotechnology Inc, RRID:AB_10649944), мышиные антитела против VDAC1/Porin (20B12AF2, ab14734, Abcam, RRID:AB_443084), кроличьи антитела против Bcl2l10 (3869S, Cell Signaling Technology, RRID:AB_2274786), кроличьи антитела против расщепленного PARP (E51, ab32064, Abcam, RRID:AB_777102), кроличьи антитела против расщепленной каспазы-3 (9661S, Cell Signaling Technology, RRID:AB_2341188), мышиные антитела к GST (B-14, sc-138, Santa Cruz Biotechnology Inc, RRID: AB_627677) и мышиные антитела к GAPDH (G-9, sc-365062, Santa Cruz Biotechnology Inc, RRID: AB_10847862).

Культура клеток и трансфекция

Запросить подробный протокол

мышиных эмбриональных фибробластов (MEF) дикого типа (WT) или нокаутных по IRBIT (KO) клеток были описаны ранее (Kawaai et al., 2015). Клетки HeLa (RRID: CVCL_0030) были получены из Центра биоресурсов RIKEN (Ибараки, Япония), где их идентичность была проверена с помощью анализа профиля полиморфизма коротких тандемных повторов (STR). Клетки MEF и клетки HeLa культивировали при 37°C с 5% CO 2 в модифицированной основной среде Дульбекко (DMEM, Nacalai Tesque) с добавлением 10% (об./об.) FBS, 50 единиц/мл пенициллина и 0,05 мг/мл стрептомицина (Nacalai Tesque). Ни одна из использованных клеточных линий не была включена в список часто ошибочно идентифицируемых клеточных линий, поддерживаемый Международным комитетом по аутентификации клеточных линий. Все клеточные линии проверяли на контаминацию микоплазмами. Клетки

HeLa трансфицировали в соответствии с инструкциями производителя реагентом X-treamGENE HP (Roche Diagnostics) для плазмид и липофектамином 2000 (Thermo Fisher Scientific) для миРНК. Для клеток MEF электропорацию проводили с использованием набора MEF 1 Nucleofector Kit (VPD-1004, Lonza) в соответствии с инструкциями производителя.

CRISPR-опосредованный ген, нацеленный на

Запросить подробный протокол

Последовательности направляющей РНК (гРНК) для экзона 2 IRBIT человека (прямой: 5′-CACCGCAAAGATCTTCGGCCAGTTT-3′, обратный: 5′-AAACAAACTGGCCGAAGATCTTTGC-3′) лигировали в сайты BbsI pSpCas9(BB)-2A-GFP ( PX458) (подарок доктора Фэн Чжана, плазмида Addgene № 48138), как описано ранее (Ran et al., 2013). PX458-гРНК трансфицировали в клетки HeLa с использованием реагента TransIT-LT1 (Mirus) в соответствии с инструкциями производителя. Клональные клеточные линии выделяли путем культивирования одиночных клеток в 96-луночные планшеты и подвергали скринингу с помощью вестерн-блоттинга с антителом против IRBIT. Геномную ДНК, содержащую целевые сайты гРНК, амплифицировали методом ПЦР с использованием праймеров, фланкирующих экзон 2 IRBIT (5’-AAAGGATCCGAACCATGTGATTACATGGC-3’, 5’-GGGAAGCTTCAAAGGTGGGCAGTCATAAC-3’, сайты рестрикционных ферментов подчеркнуты). Продукты ПЦР клонировали в сайты BamHI-HindIII pBluescript II (Stratagene), и мутации подтверждали секвенированием ДНК.

Рекомбинантный белок

Запросить подробный протокол

Рекомбинантный GST, GST-IP 3 R∆CD (также называемый GST-EL), GST-IP 3 Продукция BD (Ando et al., 2003) и продукция рекомбинантного IRBIT, выраженная в E. coli или Клетки Sf9 были описаны ранее (Ando et al., 2006).

Для получения рекомбинантного Bcl2l10-His pET-23a(+)-Bcl2l10∆TM трансформировали в BL-21. Бактерии выращивали при 37°С в среде LB, содержащей ампициллин (50 мкг/мл), до плотности клеток 0,7–0,8 (600 нм), затем добавляли 0,5 мМ ИПТГ (изопропил β-D-тиогалактозид) и инкубировали культуры при 25 ° C в течение ночи перед сбором клеток центрифугированием при 6000 x г на 10 мин. Осадок ресуспендировали в буфере для очистки (50 мМ Na 2 HPO 4 , 500 мМ NaCl, pH 8), лизировали ультразвуком в течение 5 минут и смесь центрифугировали при 15 000 x g в течение 30 минут. Полученный супернатант инкубировали в течение 30 мин при комнатной температуре на колонке ProBond (Life Technologies), предварительно инкубированной в буфере для связывания (8 М мочевина, 20 мМ Na 2 HPO 4, 500 мМ NaCl, pH 7,8). Смолу дважды промывали буфером для связывания, затем дважды буфером для связывания pH 6 и, наконец, четыре раза буфером для очистки, содержащим 50 мМ имидазола. Элюцию проводили буфером для очистки, содержащим 250 мМ имидазол, и полученный образец подвергали диализу с 50 мМ TrisHcl, pH 8, 1 мМ EDTA, 1 мМ β-меркатпоэтанол, а затем концентрировали с использованием Vivaspin6 (GE lifesciences).

Иммунопреципитация и анализ GST

Запросить подробный протокол

Для иммунопреципитации клетки HeLa промывали PBS, а затем солюбилизировали в течение 30 мин при 4°C в буфере TNE (10 мМ Tris-HCl, pH 7,4, 200 мМ NaCl, 1 мМ ЭДТА, 0,2% NP-40) с ингибитор протеиназы (полный, Roche). Лизат центрифугировали при 4°C в течение 20 мин при 16 000 x г . Супернатант предварительно очищали с помощью Protein-G-сефарозы 4B Fastflow (Protein-G, GE Healthcare), а затем инкубировали при 4°C в течение 4 часов с указанным антителом и Protein-G-сефарозой 4B Fastflow. Шарики трижды промывали буфером TNE. Осажденные белки элюировали кипячением в буфере для образцов SDS-PAGE и анализировали иммуноблоттингом с соответствующими антителами.

Для анализа GST pull-down клеточные лизаты, приготовленные, как описано выше, инкубировали с 10 мкг слитых белков GST в течение 1 часа при 4°C. После добавления глутатион-сефарозы 4B (GE Healthcare) образцы инкубировали в течение 1 часа при 4°C. Смолы трижды промывали буфером TNE, и связанные белки элюировали 20 мМ глутатиона, смешивали с буфером для образцов SDS-PAGE и анализировали иммуноблоттингом с соответствующими антителами. IP 3 (Dojindo) был добавлен в начале эксперимента, когда это было оговорено. Аналитический анализ с использованием рекомбинантных белков проводили аналогичным образом в буфере TNE с 10 мкг слитых белков GST, смешанных с рекомбинантным IRBIT (1 мкг) и/или рекомбинантным Bcl2l10 (1 мкг).

Субклеточное фракционирование

Запросить подробный протокол

Субклеточное фракционирование клеток HeLa проводили с использованием градиента Перколла, как описано ранее (Williamson et al., 2015). Вкратце, клетки HeLa гомогенизировали, пропуская через иглу 27 G 3/4 дюйма. Неочищенные митохондрии осаждали центрифугированием при 10 500 x 90 113 г 90 114 в течение 10 минут при 4 °C, а полученный супернатант дополнительно подвергали ультрацентрифугированию при 100 000 x 90 113 г 90 114 в течение 1 часа при 4°C для выделения ER. Неочищенные митохондрии наслаивали поверх 30% градиента Перколла и ультрацентрифугировали при x г в течение 65 мин при 4°C. Полосы, соответствующие MAM и чистым митохондриям, были извлечены из градиента и разбавлены PBS. Фракцию МАМ выделяли ультрацентрифугированием при 100000 х г в течение 45 мин при 4°С, а чистые митохондрии центрифугированием при 6300 х г в течение 20 мин при 4°С. Концентрацию белка в каждой фракции определяли с помощью анализа Брэдфорда (Bio-Rad), а эквивалентные количества белка (10 мкг) анализировали с помощью иммуноблоттинга с соответствующими антителами.

Вестерн-блот

Запросить подробный протокол Белки

разделяли с помощью SDS-PAGE и переносили на мембрану из поливинилидендифторида (PVDF). Мембрану блокировали в течение 1 часа при комнатной температуре с помощью 5% молока в PBS, содержащем 0,05% Tween-20 (PBS-T), и подвергали иммуноблотингу с первичными антителами, разведенными в PBS-T + 3% молока, в течение 1 часа при комнатной температуре или 16 часов. при 4°С. После промывания PBS-T мембраны инкубировали с подходящим вторичным антителом, конъюгированным с HRP. Иммунореактивные полосы обнаруживали с помощью реагентов для детекции вестерн-блоттинга ECL Select (GE Healthcare) или реагентов для детекции Immobilon Western (Millipore) и регистрировали с помощью люминесцентного анализатора изображений (LAS-4000 mini, GE Healthcare).

Вестерн-блоттинг и количественный анализ

Запросить подробный протокол Интенсивность

полос была количественно определена с использованием программного обеспечения Fiji (RRID:SCR_002285). Для количественной оценки вытягивания интенсивность полосы интересующего белка в вытягивании нормализовали по интенсивности полосы GST на той же дорожке. Это отношение (R GST ) для заданных условий затем нормализовали с помощью R GST контроля для получения относительного значения понижения. Статистическая значимость была выполнена с использованием R Значения GST .

Для количественного определения расщепленного PARP интенсивность полосы в вестерн-блоттинге расщепленного PARP (WB) нормализовали по интенсивности полосы актина WB на той же дорожке. Это соотношение (R Актин ) для данного состояния затем нормализовали по R Актин контроля (ДМСО) для получения относительного значения расщепленного PARP. Статистическая значимость была выполнена с использованием значений R Actin .

Для количественной оценки фосфорилирования интенсивность полосы в phosho-IRBIT или IRBIT WB нормализовали по интенсивности полосы Actin WB на той же дорожке. Это отношение (R Actin ) для phosho-IRBIT в определенный момент времени затем нормализовали R Actin для IRBIT в тот же момент времени для получения относительного значения фосфорилирования. Статистическая значимость была выполнена с использованием значений R Actin .

Для количественного определения Bcl2l10 и IRBIT при внутриклеточном фракционировании интенсивность полосы в Bcl2l10 или IRBIT WB нормализовали по интенсивности контрольной полосы загрузки на той же дорожке (GAPDH для Cytosol, IP 3 R для MAM и ER). Это отношение (R , нагрузка ) для данных условий затем нормализовалась по R , нагрузка контроля (ДМСО) для получения относительной интенсивности полосы. Статистическая значимость была выполнена с использованием R , загружающего значений.

2D BN-SDS СТРАНИЦА

Запросить подробный протокол

Двумерный электрофорез проводили, как описано ранее (Wittig et al., 2006). Вкратце, 200 мкг сырых митохондрий ресуспендировали в солюбилизирующем буфере (50 мМ NaCl, 50 мМ имидазола, pH 7, 2 мМ 6-аминогексановой кислоты, 1 мМ ЭДТА) и солюбилизировали дигитонином (3 г/г белка) в течение 10 минут на льду, а затем центрифугировали при 20000 x г в течение 20 мин при 4°С. К супернатанту добавляли глицерин и кумасси синий G-250 и смесь наносили на 6%-ный акриламид-трициновый гель. После обработки геля при 4°C вырезали полосу, соответствующую загруженному образцу, а затем инкубировали с 2x SDS-PAGE буфером для образца и нагревали. После 20-минутной инкубации в буфере для образцов SDS-PAGE при комнатной температуре полосу помещали на 10% акриламидный Bis-Tris SDS-гель и проводили последующий электрофорез и иммуноблоттинг, как описано в разделе Вестерн-блоттинг.

Ca

2+ визуализация Запросить подробный протокол

Для измерения цитозольного Ca 2+ клетки MEF, высеянные в чашки со стеклянным дном диаметром 35 мм (Iwaki), котрансфицировали pEGFPC1 и пустыми pBI-CMEF, pBI-CMEF-FLAG-Bcl2l10, pBI-CMEF-FLAG-IRBIT , pBI-CMEF-FLAG-IRBITS68A, pBI-CMEF-FLAG-IRBIT-FLAG-Bcl2l10 или pBI-CMEF-FLAG-IRBITS68A-FLAG-Bcl2l10 (соотношение 1:3). Для siRNA клетки HeLa, высеянные в чашки со стеклянным дном диаметром 35 мм, совместно трансфицировали 0,5 мкг pEGFPC1 и 50 пмоль siRNA. Через 24 ч после трансфекции плазмидой или через 48 ч после трансфекции миРНК клетки нагружали 5 мкМ Fura-2 AM (DOJINDO) на 30 мин, затем помещали на столик инвертированного микроскопа (IX-70; Olympus, Япония) и перфузировали сбалансированный солевой раствор (BSS, 20 мМ Hepes, pH 7,4, 115 мМ NaCl, 5,4 мМ KCl, 1 мМ MgCl 2 , 10 мМ глюкозы и 2 мМ CaCl 2 ). Клетки стимулировали АТФ, чтобы вызвать транзиторное внутриклеточное высвобождение Ca 2+ , или тапсигаргином, чтобы вызвать опорожнение ER. GFP-положительные клетки идентифицировали перед визуализацией Ca 2+ и анализировали изменение отношения (R) 340 нм/380 нм возбужденной Fura-2 флуоресценции этих клеток.

Для измерения цитозольного Ca 2+ после медикаментозного лечения клетки HeLa инкубировали с 1 мкМ STS и 5 мкМ Fura-2 в BSS в течение 30 минут перед визуализацией или в течение 3 ч 40 мин с ДМСО (1/1000) или 20 мкМ TUN в культуральной среде с последующим 30-минутным добавлением 5 мкМ Fura-2 плюс ДМСО (1/1000) или 20 мкМ TUN в BSS перед визуализацией. Ка 9Визуализацию 0007 2+ выполняли так же, как измерение цитозольного Са 2+ , и анализировали изменение отношения (R) 340 нм/380 нм для 100 клеток, выбранных случайным образом в поле.

Для измерения митохондриального Ca 2+ клетки MEF, высеянные в чашки со стеклянным дном диаметром 35 мм (Iwaki), нагружали 2,5 мкМ Rhod-2 AM (DOJINDO) на 1 час. Визуализацию Ca 2+ проводили так же, как измерение цитозольного Ca 2+ , за исключением того, что флуоресценцию регистрировали с возбуждением при 550 нм и испусканием при 59 нм.0 нм.

Для измерения митохондриального Ca 2+ после обработки лекарством клетки HeLa нагружали 2,5 мкМ Rhod-2 AM (DOJINDO) в течение 1 часа. Затем их инкубировали либо с ДМСО (1/1000), либо с 20 мкМ TUN в культуральной среде в течение 8 ч или в культуральной среде в течение 6 ч 40 мин, а затем в течение 1 ч 40 мин с 1 мкМ STS в культуральной среде. Затем были получены изображения с возбуждением при 550 нм и излучением при 590 нм с одинаковым временем экспозиции для всех условий. Затем с помощью программного обеспечения Fiji (RRID: SCR_002285) измеряли интенсивность флуоресценции каждой из клеток в поле. Значение флуоресценции каждой клетки нормализовали по среднему значению флуоресценции в контрольных условиях (ДМСО), что давало относительную флуоресценцию каждой клетки. Эту относительную флуоресценцию использовали для расчета средней относительной флуоресценции, SEM и для анализа статистической значимости.

Измерение апоптоза

Запросить подробный протокол

Для активного окрашивания каспазы-3 клетки HeLa культивировали в чашках со стеклянным дном диаметром 35 мм (Iwaki) и, по показаниям, трансфицировали либо пустыми pBI-CMEF, pBI-CMEF-FLAG-Bcl2l10, pBI-CMEF-FLAG-IRBITS68A, либо pBI-CMEF-FLAG-IRBITS68A-FLAG-Bcl2l10. Через 24 часа после трансфекции клетки обрабатывали ДМСО (1/1000, Sigma-Aldrich) в течение 24 часов, 1 мкМ стауроспорина (LKT Laboratories) в течение 4 часов, 2 мкМ тапсигаргина (Calbiochem) в течение 24 часов или 20 мкМ туникамицина (Sigma-Aldrich). Aldrich) в течение 24 часов, а затем окрашивали с использованием набора для обнаружения зеленой каспазы-3 и −7 Image-iT LIVE (ThermoFisher Scientific) в соответствии с инструкциями производителя. Изображения получали с помощью флуоресцентного микроскопа (Biozero BZ-8100, Keyence).

Для вестерн-блоттинга апоптоза клетки трансфицировали, когда это указано, пустым pHM6 или pHM6-IRBIT и обрабатывали через 24 часа после трансфекции ДМСО (1/1000, Sigma-Aldrich) в течение 24 часов, 1 мкМ стауроспорина ( LKT Laboratories) на 4 часа, 2 мкМ тапсигаргина (Calbiochem) на 24 часа или 20 мкМ туникамицина (Sigma-Aldrich) на 24 часа. После обработки клетки лизировали в буфере TNE, концентрацию белка в каждом образце определяли с помощью анализа Брэдфорда (Bio-Rad) и эквивалентные количества белка (10 мкг) анализировали с помощью иммуноблоттинга с соответствующими антителами.

Иммунофлуоресценция

Запросить подробный протокол

Клетки, культивированные на покровных стеклах, трансфицировали pcDNA3. 1-KDEL-GFP и через 24 ч после трансфекции фиксировали 4% параформальдегидом в PBS в течение 20 мин при 37°C, затем трижды промывали PBS. Затем клетки пермеабилизировали и блокировали в течение 20 минут при комнатной температуре блокирующим буфером (PBS, 5% нормальной козьей сыворотки, 0,1% Triton X-100) перед инкубацией с антителом против Tom20 (разведение 1/2000 в блокирующем буфере) в течение 1 часа. при комнатной температуре. После трех 5-минутных промывок PBS-T (PBS, 0,1% Triton X-100) клетки инкубировали со вторичным антителом (козьи антикроличьи Alexa Fluor 568, Thermofisher Scientific) в течение 1 часа при комнатной температуре, а затем промывали в течение 5 минут. с ПБС-Т трижды. Покровные стекла покрывали Vectashield (Vector Laboratories) и исследовали под конфокальным флуоресцентным микроскопом (FV1000, Olympus) с объективом ×60. Флуоресцентные изображения анализировали с помощью программного обеспечения FV10-ASW (Olympus). Коэффициенты колокализации рассчитывали с помощью плагина Coloc 2 программного обеспечения ImageJ.

Электронная микроскопия

Запросить подробный протокол

клетки HeLa, культивированные на покровных стеклах, фиксировали при комнатной температуре в течение 3 часов в 2,5% глутаральдегиде в 0,1 М фосфатном буфере, рН 7,3, а затем 3 раза промывали 0,2 М сахарозой в 0,1 М фосфатном буфере, рН 7,3. Затем образцы фиксировали 1% OsO 4 в 0,1 М фосфатном буфере с рН 7,3 в течение 1 часа и окрашивали единым блоком уранилацетатом. Затем образцы обезвоживали через градуированную серию этанола и заливали в Epon 812. Ультратонкие срезы исследовали с помощью просвечивающего электронного микроскопа (Hitachi H-7100) после двойного окрашивания уранилацетатом и цитратом свинца.

Выравнивание последовательности

Запросить подробный протокол

последовательности Nrz и Bcl2l10 были обнаружены в базе данных белков Национального центра биотехнологической информации. Выравнивание последовательностей проводили с помощью инструмента Clustal Omega по адресу http://www. ebi.ac.uk/Tools/msa/clustalo/. Изображение выравнивания было получено с помощью программного обеспечения Jalview (RRID:SCR_006459) (Waterhouse et al., 2009).

Статистический анализ

Запросить подробный протокол

Статистическая значимость была проанализирована с использованием шкалы Стьюдента 9.0113 т тест. Значения на графиках были выражены как среднее значение ± стандартная ошибка среднего, *p<0,05, **p<0,01, ***p<0,001.

Ссылки

    1. Андо Х
    2. Хиросе М
    3. Гейнче L
    4. Каваи К
    5. Бонно Б
    6. Иджуин Т
    7. Ито Т
    8. Такенава Т
    9. Микошиба К

    (2015) ИРБИТ взаимодействует с каталитическим ядром фосфатидилинозитолфосфаткиназы типов iα и iiα через консервативные каталитические остатки аспартата

    Plos One 10 :e0141569.

    https://doi.org/10.1371/journal.pone.0141569

    • пабмед
    • Google ученый
    1. Андо Х
    2. Каваи К
    3. Микошиба К

    (2014) ИРБИТ: Регулятор ионных каналов и переносчиков ионов

    Biochimica et Biophysica Acta (BBA) — Molecular Cell Research 1843 : 2195–2204.

    https://doi.org/10.1016/j.bbamcr.2014.01.031

    • Google ученый
    1. Андо Х
    2. Мизутани А
    3. Кифер Х
    4. Цузуруги Д
    5. Мичикава Т
    6. Микошиба К

    (2006) ИРБИТ подавляет активность рецептора IP3, конкурируя с IP3 за общий сайт связывания на рецепторе IP3

    Molecular Cell 22 :795–806.

    https://doi.org/10.1016/j.molcel.2006.05.017

    • пабмед
    • Google ученый
    1. Андо Х
    2. Мизутани А
    3. Мацу-ура Т
    4. Микошиба К

    (2003) IRBIT, новый белок, связывающий рецептор инозитол-1,4,5-трифосфата (IP3), высвобождается из рецептора IP3 при связывании IP3 с рецептором

    Journal of Biological Chemistry 278 :10602–10612.

    https://doi.org/10.1074/jbc.M210119200

    • пабмед
    • Google ученый
    1. Андо Х
    2. Мизутани А
    3. Микошиба К

    (2009) Гомолог IRBIT не обладает активностью связывания с рецептором инозитол-1,4,5-трифосфата из-за уникального N-концевого придатка

    Журнал нейрохимии 109 : 539–550.

    https://doi.org/10.1111/j.1471-4159.2009.05979.x

    • пабмед
    • Google ученый
    1. Ауачерия А
    2. Арно E
    3. Венет S
    4. Лалле П
    5. Гуи М
    6. Ригаль Д
    7. Жилет G

    (2001) Nrh, человеческий гомолог Nr-13, связывается с Bcl-Xs и является ингибитором апоптоза

    Oncogene 20 :5846–5855.

    https://doi.org/10.1038/sj.onc.1204740

    • пабмед
    • Google ученый
    1. Арнаутов А
    2. Дассо М

    (2014) Регуляция ферментов. IRBIT — новый регулятор рибонуклеотидредуктазы у высших эукариот

    Science 345 :1512–1515.

    https://doi.org/10.1126/science.1251550

    • пабмед
    • Google ученый
    1. Да Y
    2. Ли М
    3. Длинный MJ
    4. Вайс РС

    (2015) Рибонуклеотидредуктаза и рак: биологические механизмы и таргетная терапия

    Онкоген 34 :2011–2021.

    https://doi.org/10.1038/onc.2014.155

    • пабмед
    • Google ученый
    1. Айллон V
    2. Мартинес-A C
    3. Гарсия А
    4. Кайла Х
    5. Реболло А

    (2000) Протеинфосфатаза 1альфа представляет собой Ras-активируемую плохую фосфатазу, которая регулирует апоптоз, вызванный депривацией интерлейкина-2

    The EMBO Journal 19 :2237–2246.

    https://doi.org/10.1093/emboj/19.10.2237

    • пабмед
    • Google ученый
    1. Баннай Х
    2. Иноуэ Т
    3. Накаяма Т
    4. Хаттори М
    5. Микошиба К

    (2004) Кинезинзависимый, быстрый, двунаправленный транспорт субкомпартмента ER в дендритах нейронов гиппокампа

    Journal of Cell Science 117 :163–175.

    https://doi.org/10.1242/jcs.00854

    • пабмед
    • Google ученый
    1. Берридж MJ
    2. Бутман МД
    3. Родерик HL

    (2003) Передача сигналов кальция: динамика, гомеостаз и ремоделирование

    Nature Reviews Molecular Cell Biology 4 :517–529.

    https://doi.org/10.1038/nrm1155

    • пабмед
    • Google ученый
    1. Болт S
    2. Кордельер FP

    (2006) Экскурсия по анализу субклеточной колокализации в световой микроскопии

    Journal of Microscopy 224 :213–232.

    https://doi.org/10.1111/j.1365-2818.2006.01706.x

    • пабмед
    • Google ученый
    1. Бонно Б
    2. Нугаред A
    3. Прудент Дж
    4. Попгеоргиев Н
    5. Пейрьерас N
    6. Римох Р
    7. Жилет G

    (2014) Гомолог Bcl-2 Nrz ингибирует связывание IP3 с его рецептором, чтобы контролировать передачу сигналов кальция во время эпиболии рыбок данио 9. 0023

    Сигнализация науки 7 :ra14.

    https://doi.org/10.1126/scisignal.2004480

    • пабмед
    • Google ученый
    1. Бонно Б
    2. Прудент Дж
    3. Попгеоргиев Н
    4. Жилет G

    (2013) Неапоптотические роли семейства Bcl-2: связь с кальцием

    Biochimica et Biophysica Acta (BBA) — Molecular Cell Research 1833 :1755–1765.

    https://doi.org/10.1016/j.bbamcr.2013.01.021

    • Google ученый
    1. Босанак I
    2. Алаттия JR
    3. Мал ТК
    4. Чан Дж
    5. Таларико S
    6. Тонг ФК
    7. Тонг КИ
    8. Йошикава Ф
    9. Фуруичи Т
    10. Иваи М
    11. Мичикава Т
    12. Микошиба К
    13. Икура М

    (2002) Структура ядра, связывающего рецептор инозитол-1,4,5-трифосфата, в комплексе с его лигандом

    Nature 420 :696–700.

    https://doi.org/10.1038/nature01268

    • пабмед
    • Google ученый
    1. Церегетти GM
    2. Коста В
    3. Скоррано L

    (2010) Ингибирование Drp1-зависимой фрагментации митохондрий и апоптоза полипептидным антагонистом кальцинейрина

    Гибель клеток и дифференцировка 17 :1785–1794.

    https://doi.org/10.1038/cdd.2010.61

    • пабмед
    • Google ученый
    1. Церегетти GM
    2. Стангерлин А
    3. Мартинс де Брито O
    4. Чанг CR
    5. Блэкстоун С
    6. Бернарди П
    7. Скоррано L
    8. де Брито OM

    (2008) Дефосфорилирование кальциневрином регулирует транслокацию Drp1 в митохондрии

    PNAS 105 :15803–15808.

    https://doi.org/10.1073/pnas.0808249105

    • пабмед
    • Google ученый
    1. Коссон П
    2. Маркетти А
    3. Раваццола М
    4. Орки L
    5. Хелениус А
    6. Берридж М
    7. Орки L
    8. Раваццола М
    9. Ле СМ
    10. Шен В
    11. Деморекс N
    12. Льюис Р
    13. Тандлер Б

    (2012) Независимое от митофузина-2 сопоставление эндоплазматического ретикулума и митохондрий: ультраструктурное исследование

    PLoS One 7 :e46293.

    https://doi.org/10.1371/journal.pone.0046293

    • пабмед
    • Google ученый
    1. Чордаш Г
    2. Ренкен С
    3. Варнаи P
    4. Уолтер Л
    5. Уивер Д
    6. Батарея KF
    7. Балла Т
    8. Маннелла CA
    9. Хайноцки Г

    (2006) Структурно-функциональные особенности и значение физической связи между ЭР и митохондриями

    The Journal of Cell Biology 174 :915–921.

    https://doi. org/10.1083/jcb.200604016

    • пабмед
    • Google ученый
    1. де Брито OM
    2. Скоррано L

    (2008) Митофузин 2 привязывает эндоплазматический ретикулум к митохондриям

    Природа 456 :605–610.

    https://doi.org/10.1038/nature07534

    • пабмед
    • Google ученый
    1. Денио А
    2. Шараф-эль-Дейн О
    3. Майе E
    4. Понсе Д
    5. Кремер G
    6. Лемер C
    7. Бреннер С

    (2008) Стресс эндоплазматического ретикулума вызывает кальций-зависимый переход проницаемости, пермеабилизацию наружной мембраны митохондрий и апоптоз

    Онкоген 27 :285–299.

    https://doi.org/10.1038/sj.onc.1210638

    • пабмед
    • Google ученый
    1. Девогелэр B
    2. Белленс М
    3. Саммелс E
    4. Деруа Р
    5. Велкенс E
    6. фургон Линт J
    7. Парис JB
    8. Миссиэн Л
    9. Боллен М
    10. Де Смедт H

    (2007) Протеинфосфатаза-1 является новым регулятором взаимодействия между IRBIT и инозитол-1,4,5-трифосфатным рецептором

    Biochemical Journal 407 :303–311.

    https://doi.org/10.1042/BJ20070361

    • пабмед
    • Google ученый
    1. Филади R
    2. Греотти E
    3. Тураккио G
    4. Луини А
    5. Поццан Т
    6. Пиццо П

    (2015) Удаление митофузина 2 увеличивает сцепление эндоплазматического ретикулума с митохондриями

    PNAS 112 :E2174–E2181.

    https://doi.org/10.1073/pnas.1504880112

    • пабмед
    • Google ученый
    1. Фоскетт JK
    2. Белый С
    3. Чунг KH
    4. Мак ДО

    (2007) Каналы высвобождения Ca2+ рецептором инозитолтрифосфата

    Physiological Reviews 87 : 593–658.

    https://doi.org/10.1152/physrev.00035.2006

    • пабмед
    • Google ученый
    1. Георгий С
    2. Де Стефани D
    3. Бонони А
    4. Риццуто R
    5. Пинтон П

    (2009) Структурно-функциональная связь между митохондриальной сетью и эндоплазматическим ретикулумом

    Международный журнал биохимии и клеточной биологии 41 : 1817–1827.

    https://doi.org/10.1016/j.biocel.2009.04.010

    • пабмед
    • Google ученый
    1. Гийемин Y
    2. Корнут-Тибо A
    3. Жилет G
    4. Пенин Ф
    5. Ауачерия А

    (2011) Характеристика уникальных сигнатурных последовательностей дивергентного материнского белка Bcl2l10

    Молекулярная биология и эволюция 28 :3271–3283.

    https://doi.org/10.1093/molbev/msr152

    • пабмед
    • Google ученый
    1. Гийемин Y
    2. Лалле П
    3. Жилет G
    4. Герин JF
    5. Хамама S
    6. Ауачерия А

    (2009) Ооциты и ранние эмбрионы избирательно экспрессируют фактор выживания BCL2L10

    Журнал молекулярной медицины 87 :923–940.

    https://doi.org/10.1007/s00109-009-0495-7

    • пабмед
    • Google ученый
    1. Хэнсон CJ
    2. Бутман МД
    3. Дистельхорст CW
    4. Войцикевич RJ
    5. Родерик HL

    (2008) Bcl-2 подавляет высвобождение Са2+ через инозитол-1,4,5-трифосфатные рецепторы и ингибирует поглощение Са2+ митохондриями, не влияя на содержание кальция в ЭР

    Клеточный кальций 44 :324–338.

    https://doi.org/10.1016/j.ceca.2008.01.003

    • пабмед
    • Google ученый
    1. Он Р
    2. Чжан Х
    3. Юн CC

    (2008) ИРБИТ, белок, связывающий рецептор инозитол-1,4,5-трифосфата (IP3), высвобождаемый с помощью IP3, связывает обменник na+/H+ NHE3 и активирует активность NHE3 в ответ на кальций

    Журнал биологической химии 283 :33544–33553.

    https://doi.org/10.1074/jbc.M805534200

    • пабмед
    • Google ученый
    1. Инохара N
    2. Гурли ТС
    3. Каррио Р
    4. Муньис М
    5. Меринос J
    6. Гарсия I
    7. Косеки Т
    8. Ху Y
    9. Чен С
    10. Нуньес Г

    (1998) Diva, гомолог Bcl-2, который напрямую связывается с Apaf-1 и вызывает Bh4-независимую гибель клеток

    Журнал биологической химии 273 :32479–32486.

    https://doi.org/10.1074/jbc.273.49.32479

    • пабмед
    • Google ученый
    1. Ивасава Р
    2. Махуль-Мелье AL
    3. Датлер С
    4. Пазаренцос E
    5. Гримм S
    6. Албайрак Т
    7. Шерхаммер V
    8. Шенфельд N
    9. Бразиулис E
    10. Мунд Т
    11. Бауэр М
    12. Шеффлер I
    13. Паркос С

    (2011) Fis1 и Bap31 связывают интерфейс митохондрия-ER, чтобы создать платформу для индукции апоптоза

    The EMBO Journal 30 : 556–568.

    https://doi.org/10.1038/emboj.2010.346

    • пабмед
    • Google ученый
    1. Джаяраман Т
    2. Марки AR

    (1997) Т-клетки с дефицитом инозитол-1,4,5-трифосфатного рецептора устойчивы к апоптозу

    Молекулярная и клеточная биология 17 :3005–3012.

    https://doi.org/10.1128/MCB.17.6.3005

    • пабмед
    • Google ученый
    1. Чон В
    2. Ким ХС
    3. Ким YB
    4. Ким М. А.
    5. Лим В
    6. Ким Дж
    7. Чан Х-Джей
    8. Су ДХ
    9. Ким К
    10. Чанг HH
    11. Базер ФВ
    12. Песня YS
    13. Хан JY
    14. Песня G

    (2012) Парадоксальная экспрессия AHCYL1, влияющая на канцерогенез яичников у кур и самок

    Экспериментальная биология и медицина 237 :758–767.

    https://doi.org/10.1258/ebm.2012.011433

    • Google ученый
    1. Каваи К
    2. Хисацунэ C
    3. Курода Y
    4. Мизутани А
    5. Таширо Т
    6. Микошиба К

    (2009) 80K-H взаимодействует с рецепторами инозитол-1,4,5-трифосфата (IP3) и регулирует активность высвобождения кальция, индуцированную IP3

    Journal of Biological Chemistry 284 :372–380.

    https://doi.org/10.1074/jbc.M805828200

    • пабмед
    • Google ученый
    1. Каваи К
    2. Мизутани А
    3. Сёдзи Х
    4. Огава N
    5. Эбисуи Е
    6. Курода Y
    7. Вакана S
    8. Миякава Т
    9. Хисацунэ C
    10. Микошиба К

    (2015) ИРБИТ регулирует активность CaMKIIα и способствует гомеостазу катехоламинов посредством фосфорилирования тирозингидроксилазой

    PNAS 112 :5515–5520.

    https://doi.org/10.1073/pnas.1503310112

    • Google ученый
    1. Кифер Х
    2. Мизутани А
    3. Иемура С
    4. Нацумэ Т
    5. Андо Х
    6. Курода Y
    7. Микошиба К

    (2009) белок, связывающий рецептор инозитол-1,4,5-трифосфата, высвобождаемый с помощью инозитол-1,4,5-трифосфата (ИРБИТ), связывается с компонентами механизма процессинга мРНК 3′-зависимым от фосфорилирования образом и ингибирует полиаденилирование

    Журнал биологической химии 284 :10694–10705.

    https://doi. org/10.1074/jbc.M807136200

    • пабмед
    • Google ученый
    1. Ли Г
    2. Монгилло М
    3. Подбородок КТ
    4. Хардинг H
    5. Рон Д
    6. Марки AR
    7. Табас I

    (2009) Роль ERO1-альфа-опосредованной стимуляции активности рецептора инозитола 1,4,5-трифосфата в апоптозе, индуцированном стрессом эндоплазматического ретикулума

    The Journal of Cell Biology 186 :783–792.

    https://doi.org/10.1083/jcb.2000

    • пабмед
    • Google ученый
    1. Лю CL
    2. Он ГГ
    3. Ли Х
    4. Ли RJ
    5. Он КЛ
    6. Ван Л. Л.

    (2014) Ингибирование серин/треониновой протеинфосфатазы PP1 защищает кардиомиоциты от индуцированного туникамицином апоптоза и И/Р за счет усиления p-eIF2α

    International Journal of Molecular Medicine 33 :499–506.

    https://doi.org/10.3892/ijmm.2013.1603

    • пабмед
    • Google ученый
    1. Ма С
    2. Ян Y
    3. Ван С
    4. Хуэй N
    5. ГУ Л
    6. Чжун Х
    7. Кай Z
    8. Ван Q
    9. Чжан Кью
    10. Ли Н
    11. Цао Х

    (2009) Эндогенный белок-ингибитор CaMKII человека подавляет рост опухоли, вызывая остановку клеточного цикла и апоптоз посредством подавления пути фосфатидилинозитид-3-киназы/Akt/HDM2

    Journal of Biological Chemistry 284 :24773–24782.

    https://doi.org/10.1074/jbc.M109.028621

    • пабмед
    • Google ученый
    1. Микошиба К

    (2007) Рецептор IP3/Канал Ca2+: от открытия к новым концепциям передачи сигналов

    Журнал нейрохимии 102 :1426–1446.

    https://doi.org/10.1111/j.1471-4159.2007.04825.x

    • пабмед
    • Google ученый
    1. Монако G
    2. Дерок E
    3. Акл H
    4. Понсартс R
    5. Вервлит Т
    6. Луйтен Т
    7. Де Майер М
    8. Миссиэн Л
    9. Дистельхорст CW
    10. Де Смедт H
    11. Парис JB
    12. Лейберт Л
    13. Балтынк G

    (2012) Селективная регуляция опосредованной IP3-рецептором передачи сигналов Ca2+ и апоптоза доменом Bh5 Bcl-2 по сравнению с Bcl-Xl

    Гибель клеток и дифференцировка 19 :295–309.

    https://doi.org/10.1038/cdd.2011.97

    • пабмед
    • Google ученый
    1. Гайка LK
    2. Марголис СС
    3. Дженсен М
    4. Герман СЕ
    5. Данфи WG
    6. Ратмелл JC
    7. Корнблют S

    (2005) Метаболическая регуляция гибели клеток ооцитов посредством CaMKII-опосредованного фосфорилирования каспазы-2

    Клетка 123 :89–103.

    https://doi.org/10.1016/j.cell.2005.07.032

    • пабмед
    • Google ученый
    1. Парк S
    2. Щейников N
    3. Хонг JH
    4. Чжэн С
    5. Су SH
    6. Каваи К
    7. Андо Х
    8. Мизутани А
    9. Абэ Т
    10. Киёнари H
    11. Секи Г
    12. Юл Д
    13. Микошиба К
    14. Муаллем S

    (2013) Ирбит опосредует синергизм между сигнальными путями ca(2+) и цАМФ во время эпителиального транспорта у мышей

    Гастроэнтерология 145 :232–241.

    https://doi.org/10.1053/j.gastro.2013.03.047

    • пабмед
    • Google ученый
    1. Пинтон П
    2. Риццуто R

    (2006) Гомеостаз Bcl-2 и Ca2+ в эндоплазматическом ретикулуме

    Гибель клеток и дифференцировка 13 :1409–1418.

    https://doi.org/10.1038/sj.cdd.4401960

    • пабмед
    • Google ученый
    1. Прудент Дж
    2. Зунино Р
    3. Сугиура А
    4. Мэтти С
    5. Шор GC
    6. Макбрайд HM

    (2015) MAPL SUMOylation Drp1 стабилизирует ER/митохондриальную платформу, необходимую для гибели клеток

    Molecular Cell 59 :941–955.

    https://doi.org/10.1016/j.molcel.2015.08.001

    • пабмед
    • Google ученый
    1. Пунтони F
    2. Вилла-Моруцци E

    (1999) активация протеинфосфатазы-1 и ассоциация с белком ретинобластомы при колцемид-индуцированном апоптозе

    Biochemical and Biophysical Research Communications 266 : 279–283.

    https://doi.org/10.1006/bbrc.1999.1800

    • пабмед
    • Google ученый
    1. Ран ФА
    2. Сюй PD
    3. Райт Дж
    4. Агарвала V
    5. Скотт Д. А.
    6. Чжан Ф

    (2013) Геномная инженерия с использованием системы CRISPR-Cas9

    Nature Protocols 8 :2281–2308.

    https://doi.org/10.1038/nprot.2013.143

    • пабмед
    • Google ученый
    1. Родригес А
    2. Рой Дж
    3. Мартинес-Мартинес S
    4. Лопес-Мадеруэло MD
    5. Ниньо-Морено P
    6. Орти Л
    7. Пантоха-Учеда D
    8. Пинеда-Лусена A
    9. Сайерт МС
    10. Редондо JM

    (2009) Сохраняющаяся стыковочная поверхность кальцинейрина обеспечивает взаимодействие с субстратами и иммунодепрессантами

    Molecular Cell 33 :616–626.

    https://doi.org/10.1016/j.molcel.2009.01.030

    • пабмед
    • Google ученый
    1. Ронг YP
    2. Балтынк G
    3. Аромоларан AS
    4. Чжун Ф
    5. Парис JB
    6. Де Смедт H
    7. Миньери GA
    8. Родерик HL
    9. Бутман МД
    10. Дистельхорст CW

    (2009) Домен Bh5 Bcl-2 ингибирует высвобождение кальция из ER и апоптоз путем связывания регуляторного и связывающего домена рецептора IP3

    PNAS 106 :14397–14402.

    https://doi.org/10.1073/pnas.05106

    • пабмед
    • Google ученый
    1. Шибасаки F
    2. Кондо Е
    3. Акаги Т
    4. МакКеон F

    (1997) Подавление передачи сигналов через транскрипционный фактор NF-AT за счет взаимодействия между кальциневрином и Bcl-2

    Природа 386 :728–731.

    https://doi.org/10.1038/386728a0

    • пабмед
    • Google ученый
    1. Симидзу С
    2. Кониши А
    3. Кодама Т
    4. Цудзимото Ю

    (2000) Домен Bh5 антиапоптотических представителей семейства Bcl-2 закрывает потенциалзависимый анионный канал и ингибирует апоптотические митохондриальные изменения и гибель клеток

    PNAS 97 :3100–3105.

    https://doi.org/10.1073/pnas.97.7.3100

    • пабмед
    • Google ученый
    1. Ширакабе К
    2. Приори G
    3. Ямада H
    4. Андо Х
    5. Хорита С
    6. Фуджита Т
    7. Фудзимото I
    8. Мизутани А
    9. Секи Г
    10. Микошиба К

    (2006) IRBIT, белок, связывающий рецептор инозитол-1,4,5-трифосфата, специфически связывается и активирует Na+/HCO3-котранспортер 1 поджелудочной железы (pNBC1)

    PNAS 103 :9542–9547.

    https://doi.org/10.1073/pnas.0602250103

    • пабмед
    • Google ученый
    1. Слупе AM
    2. Меррилл РА
    3. Флиппо KH
    4. Лобас М.А.
    5. Хаутман JC
    6. Стрэк S

    (2013) Мотив стыковки кальциневрина (LXVP) в родственном динамину белке 1 способствует фрагментации митохондрий и ишемическому повреждению нейронов

    Журнал биологической химии 288 : 12353–12365.

    https://doi.org/10.1074/jbc.M113.459677

    • пабмед
    • Google ученый
    1. Песня Б
    2. Лай Б
    3. Чжэн Z
    4. Чжан И
    5. Луо Дж
    6. Ван С
    7. Чен Ю
    8. Вуджетт JR
    9. Ли М

    (2010) Ингибирующее фосфорилирование GSK-3 с помощью CaMKII связывает деполяризацию с выживанием нейронов

    Journal of Biological Chemistry 285 :41122–41134.

    https://doi.org/10.1074/jbc.M110.130351

    • пабмед
    • Google ученый
    1. Стойка R
    2. Де Вос KJ
    3. Пайюссон S
    4. Мюллер С
    5. Санчо
    6. ринггитов
    7. Лау КФ
    8. Бискай-Баррена G
    9. Лин WL
    10. Сюй YF
    11. Льюис Дж
    12. Диксон DW
    13. Петручелли Л
    14. Митчелл Дж. К.
    15. Шоу CE
    16. Миллер CC

    (2014) Ассоциации ER-митохондрий регулируются взаимодействием VAPB-PTPIP51 и нарушаются TDP-43

    , связанным с ALS/FTD, Nature Communications 5 :3996.

    https://doi.org/10.1038/ncomms4996

    • пабмед
    • Google ученый
    1. Шабадкай Г
    2. Бьянки К
    3. Варнаи P
    4. Де Стефани D
    5. Вецковски MR
    6. Каванья D
    7. Надя AI
    8. Балла Т
    9. Риццуто R

    (2006) Шаперон-опосредованное соединение эндоплазматического ретикулума и митохондриальных каналов Ca2+

    The Journal of Cell Biology 175 :901–911.

    https://doi. org/10.1083/jcb.200608073

    • пабмед
    • Google ученый
    1. Салаи Г
    2. Кришнамурти Р
    3. Хайноцки Г

    (1999) Апоптоз, управляемый IP(3)-связанными сигналами митохондриального кальция

    The EMBO Journal 18 :6349–6361.

    https://doi.org/10.1093/emboj/18.22.6349

    • пабмед
    • Google ученый
    1. Тайюллатил F
    2. Чатот S
    3. Шахин А
    4. Кижаккаил Ж
    5. Хаго А
    6. Патель М
    7. Галадари С

    (2011) Зависимое от протеинфосфатазы 1 дефосфорилирование Akt является основным сигнальным событием при индуцированном сфингозином апоптозе в клетках Jurkat

    Journal of Cellular Biochemistry 112 :1138–1153.

    https://doi.org/10.1002/jcb.23033

    • пабмед
    • Google ученый
    1. Верфайи Т
    2. Рубио N
    3. Гарг
    4. г. н.э.
    5. Балтынк G
    6. Риццуто R
    7. Декайпере JP
    8. Пьетт J
    9. Линехан С
    10. Гупта С
    11. Самали А
    12. Агостинис П

    (2012) PERK требуется в местах контакта ER-митохондрий для передачи апоптоза после стресса ER на основе АФК

    Гибель клеток и дифференцировка 19 :1880–1891.

    https://doi.org/10.1038/cdd.2012.74

    • пабмед
    • Google ученый
    1. Ван HG
    2. Рапп УР
    3. Рид JC

    (1996) Bcl-2 нацеливает протеинкиназу Raf-1 на митохондрии

    Клетка 87 :629–638.

    https://doi.org/10.1016/S0092-8674(00)81383-5

    • пабмед
    • Google ученый
    1. Ван HG
    2. Патан N
    3. Этелл ИМ
    4. Краевский С
    5. Ямагути Y
    6. Шибасаки Ф
    7. МакКеон F
    8. Бобо Т
    9. Франке ТФ
    10. Рид JC

    (1999) Ca2+-индуцированный апоптоз посредством дефосфорилирования кальцинейрином BAD

    Science 284 :339–343.

    https://doi.org/10.1126/science.284.5412.339

    • пабмед
    • Google ученый
    1. Ван RH
    2. Лю CW
    3. Аврамис VI
    4. Берндт N

    (2001) Опосредованная протеинфосфатазой 1альфа стимуляция апоптоза связана с дефосфорилированием белка 9 ретинобластомы.0023

    Онкоген 20 :6111–6122.

    https://doi.org/10.1038/sj.onc.1204829

    • пабмед
    • Google ученый
    1. Уотерхаус AM
    2. Проктер JB
    3. Мартин DM
    4. Зажим М
    5. Бартон GJ

    (2009) Jalview версии 2 — редактор множественного выравнивания последовательностей и инструментальные средства анализа

    Биоинформатика 25 :1189–1191.

    https://doi.org/10.1093/биоинформатика/btp033

    • пабмед
    • Google ученый
    1. Вэй Г
    2. Чен YB
    3. Чен ДФ
    4. Лай XP
    5. Лю DH
    6. Дэн РД
    7. Чжоу JH
    8. Чжан SX
    9. Ли YW
    10. Лии Х
    11. Лю Л.Ф.
    12. Ван Q
    13. Ни Х
    14. Ли YW LH

    (2013) Бета-азарон ингибирует апоптоз нейронов через сигнальный путь CaMKII/CREB/Bcl-2 в модели in vitro и на мышах AβPP/PS1

    Journal of Alzheimer’s Disease 33 : 863–880.

    https://doi.org/10.3233/JAD-2012-120865

    • пабмед
    • Google ученый
    1. Вэй JY
    2. Ли ВМ
    3. Чжоу LL
    4. Лу QN
    5. Он W

    (2015) Мелатонин индуцирует апоптоз клеток колоректального рака посредством импорта в ядро ​​HDAC4, опосредованного инактивацией CaMKII

    Journal of Pineal Research 58 :429–438.

    https://doi.org/10.1111/jpi.12226

    • пабмед
    • Google ученый
    1. Белый С
    2. Ли С
    3. Ян Дж
    4. Петренко Н. Б.
    5. Мадеш М
    6. Томпсон CB
    7. Фоскетт JK

    (2005) Ворота эндоплазматического ретикулума к апоптозу посредством модуляции Bcl-X (L) InsP3R

    Nature Cell Biology 7 :1021–1028.

    https://doi.org/10.1038/ncb1302

    • пабмед
    • Google ученый
    1. Уильямсон CD
    2. Вонг ДС
    3. Бозидис П
    4. Чжан А
    5. Кольберг-Поли AM

    (2015) Выделение эндоплазматического ретикулума, митохондрий и митохондриально-ассоциированных мембран и мембранных фракций, устойчивых к детергентам, из трансфицированных клеток и первичных фибробластов, инфицированных цитомегаловирусом человека

    https://doi. org/10.1002/0471143030.cb0327s68

    • пабмед
    • Google ученый
    1. Виттиг I
    2. Браун HP
    3. Шеггер H

    (2006) Синий натив СТРАНИЦА

    Nature Protocols 1 :418–428.

    https://doi.org/10.1038/nprot.2006.62

    • пабмед
    • Google ученый
    1. Виттиг R
    2. Несслинг М
    3. Воля РД
    4. Молленхауэр J
    5. Саловский Р
    6. Мюнстерманн E
    7. Шик М
    8. Хельмбах H
    9. Гшвендт B
    10. Корн Б
    11. Киоскис П
    12. Лихтер P
    13. Шадендорф D
    14. Пустка А

    (2002)

    Гены-кандидаты перекрестной устойчивости к препаратам, повреждающим ДНК

    Cancer Research 62 :6698–6705.

    • пабмед
    • Google ученый
    1. Ян Д
    2. Щейников N
    3. Цзэн В
    4. Охана Е
    5. Итак, я
    6. Андо Х
    7. Мизутани А
    8. Микошиба К
    9. Муаллем S
    10. Итак, я AH

    (2009) IRBIT координирует секрецию эпителиальной жидкости и HCO 3 путем стимуляции транспортеров pNBC1 и CFTR в протоке поджелудочной железы мышей

    Журнал клинических исследований 119 :193–202.

    https://doi. org/10.1172/JCI36983

    • пабмед
    • Google ученый
    1. Юле RJ
    2. Штрассер А

    (2008) Семейство белков BCL-2: противоположная активность, опосредующая гибель клеток

    Nature Reviews Молекулярно-клеточная биология 9 :47–59.

    https://doi.org/10.1038/nrm2308

    • пабмед
    • Google ученый

Письмо-решение

Благодарим вас за отправку статьи «ИРБИТ контролирует апоптоз путем взаимодействия с гомологом BCl-2, Bcl2l10, и способствуя контакту ER-митохондрий» на рассмотрение eLife . Ваша статья была положительно оценена Тони Хантером как старшим редактором и тремя рецензентами, в том числе Ричардом С. Льюисом (рецензент №1), который является членом нашего Совета редакторов-рецензентов, и Дэвидом Юлом (рецензент №2).

Рецензенты обсудили обзоры друг с другом, и редактор-рецензент подготовил это решение, чтобы помочь вам подготовить исправленное представление.

Резюме:

В этой статье Bonneau et al. описывают новую роль IRBIT в стимулировании апоптоза посредством его взаимодействия с гомологом Bcl2, Bcl2l10 и IP 3 рецептор. Они представляют доказательства того, что три белка образуют комплекс в точках контакта между ER и митохондриями, который ингибирует IP 3 R-опосредованное высвобождение Ca 2+ в большей степени, чем Bcl2l10 или IRBIT по отдельности. Дальнейшие результаты поддерживают предложенную модель, в которой апоптотические стимулы приводят к дефосфорилированию IRBIT, высвобождению его и Bcl2l10 из IP 3 R и, таким образом, увеличению переноса Ca 2+ из ER в митохондрии и стимулированию апоптоза. Статья важна тем, что представляет механизм, лежащий в основе новой роли IRBIT в промотировании апоптоза.

Все три рецензента согласились с тем, что статья представляет значительный интерес, статья написана четко, а данные в основном высокого качества. Однако некоторые из наиболее важных механистических выводов нуждаются в более сильной экспериментальной поддержке. Мы будем готовы рассмотреть пересмотренную версию, если она будет содержать новые данные и анализ, касающиеся следующих основных вопросов.

Существенные изменения:

1) Необходимы эксперименты, чтобы подтвердить вывод о том, что дефосфорилированный IRBIT контролирует эффект эндогенного Bcl2l10 на ER Ca 2+ высвобождение и апоптоз. На рисунке 5C-E сверхэкспрессия S68A IRBIT сама по себе не влияет на высвобождение Ca 2+ или апоптоз в клетках HeLa, что не согласуется с предполагаемой ролью дефосфорилированного IRBIT в удалении эндогенного Bcl2l10 из IP 3 R. Эти результаты повышают вероятность того, что IRBIT изменяет эффект Bcl2l10 только тогда, когда последний сверхэкспрессирован. Необходимы новые данные, чтобы показать, что эндогенный Bcl2l10 сам по себе влияет на перенос Ca 2+ в митохондрии с использованием нокаутных или нокаутных клеток Bcl2l10. Кроме того, отсутствие эффекта, наблюдаемого при экспрессии IRBIT S68A на Ca 9Версия 0007 2+ нуждается в объяснении; возможно, стимуляция с пониженным [АТФ] поможет выявить эффект.

2) Модель, в которой IRBIT способствует апоптозу путем удаления Bcl2l10 из IP 3 R и увеличения переноса Ca 2+ из ER в митохондрии, не может легко объяснить эффекты IRBIT на Tg-опосредованный апоптоз (рис. 4G, 5E). ). Tg истощает Ca 2+ из ER, предотвращая длительный перенос Ca 2+ из ER в митохондрии; поэтому не ожидается, что Tg вызовет IRBIT/Bcl2l10/IP 3 R механизм или быть чувствительным к ER-митохондриальным контактам. Способность IRBIT KO оказывать такое сильное влияние на апоптоз, индуцированный Tg (рис. 4A, B), предполагает, что задействованы критические мишени, отличные от IP 3 R, или индукция MAM. Этот вопрос необходимо решить, так как он поднимает вопрос о том, какая часть эффектов IRBIT на апоптоз на самом деле обусловлена ​​путем Bcl2l10-IP 3 R. Чтобы связать этот механизм с апоптозом, необходимо представить доказательства того, что различные используемые стимулы (особенно STS и Tun) способствуют апоптозу, в частности, за счет увеличения ER-митохондриального Ca 9.0007 2+ и что их влияние на фосфорилирование IRBIT и локализацию IRBIT/Bcl2l10 (фиг. 4) коррелирует с апоптозом (фиг. 5E).

3) Необходимы дополнительные данные для подтверждения причинной, а не корреляционной связи между ИРБИТ и прогрессированием апоптоза. Важно показать, что (1) апоптотические стимулы усиливают вызванный АТФ ER-митохондриальный перенос Са и что IRBIT KO уменьшает этот эффект апоптотических стимулов; и (2) высвобождение IRBIT/Bcl2l10 причинно связано с усиленным апоптозом. # 2 может быть достигнуто с использованием мутантного IRBIT, который не может быть дефосфорилирован (например, фосфомиметический мутант), который, по прогнозам, останется связанным с IP 9. 0005 3 R и уменьшить влияние апоптотических стимулов на перенос Ca 2+ в митохондрии.

4) Чтобы строго обосновать многие из важных выводов статьи, необходимо количественно оценить изменения в количестве или местоположении белка, полученные с помощью вестерн-блоттинга. Должны быть показаны плотность полос, количество повторений и статистический анализ. Это относится к рисункам 2C-E, 3F, 4B, 4G и 5A-B. Эти изменения должны быть относительно простыми, даже с учетом повторения некоторых экспериментов.

https://doi.org/10.7554/eLife.19896.014

Ответ автора

Важные изменения:

1) Необходимы эксперименты, чтобы подтвердить вывод о том, что дефосфорилированный IRBIT контролирует эффект эндогенного Bcl2l10 на высвобождение ER Ca 2+ и апоптоз. На фигуре 5C-E сверхэкспрессия S68A IRBIT сама по себе не влияет на высвобождение Ca 2+ или апоптоз в клетках HeLa, что не согласуется с предполагаемой ролью дефосфорилированного IRBIT в удалении эндогенного Bcl2l10 из ИП 3 Р . Эти результаты повышают вероятность того, что IRBIT изменяет эффект Bcl2110 только в том случае, когда последний сверхэкспрессирован. Необходимы новые данные, чтобы показать, что эндогенный Bcl2l10 сам по себе влияет на перенос Ca2+ в митохондрии, используя нокаутные или нокаутные клетки Bcl2l10. Кроме того, необходимо объяснить отсутствие влияния экспрессии IRBIT S68A на высвобождение Ca2+; возможно, стимуляция с пониженным [АТФ] поможет выявить эффект.

По мнению рецензентов, влияние ИРБИТ S68A на Ca 9Высвобождение 0007 2+ может быть замаскировано из-за высокого высвобождения Ca 2+ в наших экспериментальных условиях. Эксперименты по высвобождению Ca 2+ проводили в клетках MEF IRBIT KO, которые действительно демонстрируют сильное высвобождение Ca 2+ после обработки АТФ. Затем мы исследовали действие IRBIT S68A на клетки HeLa IRBIT KO, которые демонстрируют более слабое высвобождение Ca 2+ . Используя эти клетки, мы обнаружили, что сверхэкспрессия только IRBIT S68A увеличивает IICR в той же степени, что и нокдаун Bcl2l10 с использованием siRNA. Мы считаем, что эти данные подтверждают вывод о том, что дефосфорилированный IRBIT контролирует эффект эндогенного Bcl2l10 на ER Ca 9.0007 2+ выпуск. Эти данные были добавлены к рисунку 6 (рис. 6E и 6F), а текст, относящийся к этим панелям, был добавлен во второй абзац подраздела «Нефосфорилированный IRBIT ингибирует функцию Bcl2l10 в ER».

Что касается отсутствия влияния IRBIT S68A на апоптоз, эти эксперименты были проведены на клетках HeLa, содержащих эндогенный IRBIT. Ранее предполагалось, что эндогенный уровень фосфорилированного ИРБИТ может быть достаточно высоким для насыщения взаимодействия с IP 9.0005 3 R, поскольку сверхэкспрессия IRBIT в клетках, содержащих эндогенный IRBIT, не влияет на высвобождение Ca 2+ (см. Ando et al., Mol Cell, 2006). Итак, сходным образом возможно, что пул эндогенного IRBIT, который дефосфорилируется во время апоптоза, достаточен для удаления большей части Bcl2l10 из мембран ER и затем способствует апоптозу. Сверхэкспрессия IRBIT S68A в этих условиях может не оказывать существенного влияния на удаление эндогенного Bcl2l10, а затем и на апоптоз.

2) Модель, в которой IRBIT способствует апоптозу путем удаления Bcl2l10 из IP 3 R и усиления переноса Ca 2+ из ER в митохондрии, не может легко объяснить влияние IRBIT на Tg-опосредованный апоптоз (рис. 4G, 5Е). Tg истощает Ca 2+ из ER, предотвращая длительный перенос Ca 2+ из ER в митохондрии; следовательно, нельзя ожидать, что Tg активирует механизм IRBIT/Bcl2l10/ IP 3 R или будет чувствителен к ER-митохондриальным контактам. Способность ИРБИТ-КО оказывать столь сильное влияние на апоптоз, индуцированный ТГ (рис. 4А, В), указывает на другие важные мишени, помимо IP 3 R или индукция MAM. Этот вопрос необходимо решить, так как он поднимает вопрос о том, какая часть эффектов IRBIT на апоптоз на самом деле обусловлена ​​путем Bcl2l10- IP 3 R . Чтобы связать этот механизм с апоптозом, необходимо представить доказательства того, что различные использованные стимулы (особенно STS и Tun) способствуют апоптозу, специфически увеличивая ER-митохондриальный перенос Ca 2+ , и что их влияние на фосфорилирование IRBIT и локализацию IRBIT /Bcl2l10 (рис. 4) коррелируют с апоптозом (рис. 5E).

Рецензенты подняли здесь очень важный вопрос. Мы согласны с тем, что Tg истощает Ca 2+ из ER, и тогда мы можем считать, что Tg-зависимый апоптоз не зависит от ER-митохондриального переноса Ca 2+ .

Однако было показано, что ингибирование IP 3 R ослабляет Tg-зависимый апоптоз, тогда как стимуляция IP 3 R ускоряет Tg-зависимый апоптоз (Luciani et al., Diabetes 2009 Feb; 58(2): 422-432 ). Таким образом, IP 3 R, по-видимому, играет роль в гибели клеток после обработки Tg и высвобождения Bcl2l10 из IP 9.0005 3 R может облегчить это. Однако мы согласны с тем, что перенос Ca 2+ ER-митохондрий, вероятно, не является самым важным триггером Tg-зависимого апоптоза.

С другой стороны, сообщалось, что Bcl2l10 взаимодействует с Bik и Bax (Rautureau et al., Cell Death Dis. 2012 Dec 13;3:e443.). Bik представляет собой белок, содержащий только Bh4, который локализован в ER благодаря домену TM (Germain et al. , 2002 May 17; 277(20):18053-60). Bax также может локализоваться в ER, где он индуцирует апоптоз (Nutt et al., J Biol Chem. 2002 Jun 7; 277(23):20301-8; Zong et al., J Cell Biol. 2003 Jul 7; 162(1). ):59-69). Следует отметить, что Bik участвует в рекрутировании Bax в ER (Mathai et al., J Biol Chem. 2005 Jun 24; 280(25):23829-36). Интересно, что Bik необходим для индуцированной Tg гибели клеток (Lopez et al., Cell Death Differ. 2012 Sep; 19(9):1459-69), а Tg способствует димеризации Bax в ER, что индуцирует последующий апоптоз (Zong et al. , J Cell Biol., 2003, июль 7;162(1):59-69).

Затем, после обработки Tg, дефосфорилирование IRBIT и последующее удаление Bcl2l10 из мембран ER может способствовать активности Bik и Bax в ER, поскольку Bcl2l10 больше не взаимодействует с этими проапоптотическими белками и не ингибирует их.

Этот механизм может объяснить влияние IRBIT KO на Tg-индуцированную гибель клеток и влияние Tg на фосфорилирование IRBIT и локализацию IRBIT/Bcl2l10. Однако, поскольку у нас еще нет экспериментальных доказательств, подтверждающих эту модель, и по соображениям ясности мы решили удалить из рукописи все данные, относящиеся к тапсигаргину, и сосредоточиться на STS и туникамицине. Затем в соответствии с запросом мы проверили, что эти стимулы оказывают сходное влияние на фосфорилирование IRBIT и локализацию IRBIT/Bcl2l10. Таким образом, рисунок 4 был изменен соответствующим образом. Более того, мы сопоставили это с апоптозом на рисунке 5E (теперь рисунок 6G). Наконец, мы проанализировали митохондриальный Ca 2+ с Rhod-2 после обработки STS и TUN, и мы обнаружили, что эти стимулы значительно увеличивают митохондриальный [Ca 2+ ], тогда как этот эффект значительно ослабляется в клетках IRBIT KO (рис. 5D и E). В совокупности эти новые результаты показывают, что STS и TUN действуют на IRBIT и Bcl2l10 и способствуют переносу Ca 2+ в митохондрии.

3) Необходимы дополнительные данные для подтверждения причинной, а не корреляционной связи между ИРБИТ и прогрессированием апоптоза. Важно показать, что (1) апоптотические стимулы усиливают вызванный АТФ ER-митохондриальный перенос Са и что IRBIT KO уменьшает этот эффект апоптотических стимулов; и (2) высвобождение IRBIT/Bcl2l10 причинно связано с усиленным апоптозом. # 2 может быть достигнуто с использованием мутантного IRBIT, который не может быть дефосфорилирован (например, фосфомиметический мутант), который, по прогнозам, останется связанным с IP 3 R и уменьшить влияние апоптотических стимулов на перенос Ca 2+ в митохондрии.

1) Были проведены эксперименты, показывающие, что обработка STS и TUN усиливает АТФ-индуцированное высвобождение Ca 2+ в клетках WT (рис. 5A, B и C). Мы также показываем на этих рисунках, что этот эффект STS и TUN значительно снижается в клетках IRBIT KO. Более того, на рисунках 5D и E мы не показываем, что ИРБИТ КО также значительно снижает уровень митохондриального [Ca 2+ ] после обработки STS и TUN. Эти новые данные показывают, что IRBIT играет ключевую роль в развитии апоптоза, облегчая перенос ER-митохондрий Ca 2+ .

2) Мы создали несколько фосфомиметических мутантов (мутации Ser в Glu или Asp) IRBIT, чтобы ответить на этот вопрос. Однако все созданные мутанты не смогли связать IP 3 BD IP 3 R (см. ответ автора, изображение 1). Фосфорилирование ИРБИТ необходимо для связывания с IP 3 R встречается в внутренне неупорядоченной области (Ando et al., PLoS One. 2015 Oct 28;10(10):e0141569), и последовательное фосфорилирование IRBIT может быть важным для структурирования этой области. Добавление отрицательного заряда для имитации фосфорилирования может не воспроизвести эффект фосфорилирования. Затем, несмотря на наши усилия, мы не смогли провести эксперименты, которые могли бы ответить на этот вопрос.

Вестерн-блот GST-pulldown, выполненный с помощью GST-IP
3 BD на лизатах клеток HeLa, экспрессирующих FLAG-IRBIT (WT) или меченных FLAG мутантов IRBIT.

Мутации: SDDD: S71D, S74D и S77D; ДОБАВИТЬ: S68A, S71D, S74D и S77D; DDDD: S68D, S71D, S74D и S77D; EDDD: S68E, S71D, S74D и S77D.

https://doi.org/10.7554/eLife.19896.013

4) Чтобы строго обосновать многие из важных выводов статьи, необходимо количественно оценить изменения содержания или местоположения белка, полученные с помощью вестерн-блоттинга. Должны быть показаны плотность полос, количество повторений и статистический анализ. Это относится к рисункам 2C-E, 3F, 4B, 4G и 5A-B. Эти изменения должны быть относительно простыми, даже с учетом повторения некоторых экспериментов.

Проведена количественная оценка вестерн-блоттинга. Относительная плотность полос, а также статистический анализ были добавлены к рисункам 2C-E, 4B, 4G и 5A-B (теперь рисунок 6A-B). Количество повторений теперь отображается в подписях к рисункам. Кроме того, метод, используемый для количественной оценки и анализа этих вестерн-блотов, теперь описан в разделе «Материалы и методы». Что касается рисунка 3F, мы не понимаем, что нужно оценивать количественно, поскольку этот рисунок просто описывает субклеточную локализацию IRBIT и Bcl2l10. Текст, относящийся к этой фигуре в исходной рукописи, вероятно, был запутанным, и он был изменен, чтобы сделать его более ясным.

https://doi.org/10.7554/eLife.19896.015

Статья и информация об авторе

Сведения об авторе

  1. Бенджамин Бонно
    Лаборатория нейробиологии развития, Институт исследований мозга RIKEN, Вако-ши, Япония
    Вклад
    BB, Концепция и дизайн, Сбор данных, Анализ и интерпретация данных, Составление или редактирование статьи
    Для корреспонденции
    [email protected]
    Конкурирующие интересы
    Авторы заявляют об отсутствии конкурирующих интересов. «Этот ORCID iD идентифицирует автора этой статьи:» 0000-0003-2302-5369
  2. Хидэаки Андо
    Лаборатория нейробиологии развития, Институт исследований мозга RIKEN, Вако-ши, Япония
    Вклад
    HA, Сбор данных, Анализ и интерпретация данных, Составление или редактирование статьи
    Конкурирующие интересы
    Авторы заявляют об отсутствии конкурирующих интересов.
  3. Кацухиро Кавааи
    Лаборатория нейробиологии развития, Институт исследований мозга RIKEN, Вако-ши, Япония
    Вклад
    КК, Сбор данных, Анализ и интерпретация данных, Составление или редактирование статьи
    Конкурирующие интересы
    Авторы заявляют об отсутствии конкурирующих интересов.
  4. Мацуми Хиросе
    Лаборатория нейробиологии развития, Институт исследований мозга RIKEN, Вако-ши, Япония
    Вклад
    MH, Сбор данных, Предоставление неопубликованных основных данных или реагентов
    Конкурирующие интересы
    Авторы заявляют об отсутствии конкурирующих интересов.
  5. Хироми Такахаси-Иванага
    Кафедра анатомии, Медицинский факультет Университета Хоккайдо, Саппоро, Япония
    Вклад
    HT-I, Сбор данных, Анализ и интерпретация данных
    Конкурирующие интересы
    Авторы заявляют об отсутствии конкурирующих интересов.
  6. Кацухико Микошиба
    Лаборатория нейробиологии развития, Институт исследований мозга RIKEN, Вако-ши, Япония
    Вклад
    КМ, Концепция и дизайн, Составление или доработка статьи
    Для корреспонденции
    [email protected]
    Конкурирующие интересы
    Авторы заявляют об отсутствии конкурирующих интересов. «Этот ORCID iD идентифицирует автора этой статьи:» 0000-0002-3487-6970

Финансирование

Японское общество содействия развитию науки
  • Бенджамин Бонно
РИКЕН
  • Бенджамин Бонно

Спонсоры не участвовали в разработке исследования, сборе и интерпретации данных или принятии решения о представлении работы для публикации.

Благодарности

Мы благодарим Пр. Germain Gillet за предоставление вектора pSG5-FLAG-Bcl2l10. Эта работа была поддержана RIKEN (специальный научный сотрудник с докторской степенью [SPDR]), Японским обществом содействия развитию науки (международный научный сотрудник) и Международным совместным исследовательским проектом JST — исследования, ориентированные на поиск решений в области науки и технологий.

Редактор-рецензент

  1. Ричард С. Льюис, Медицинский факультет Стэнфордского университета, США

История публикаций

  1. Поступило: 27 июля 2016 г.
  2. Принято: 24 ноября 2016 г.
  3. Версия записи опубликована: 20 декабря 2016 г. (версия 1)

Авторское право

© 2016, Bonneau et al.

Эта статья распространяется в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование и распространение при условии указания оригинального автора и источника.

Метрики

Число цитирований статей, полученное путем опроса самых высоких значений из следующих источников: Scopus, Crossref, PubMed Central.

Ссылки для скачивания

Список ссылок, состоящий из двух частей, для загрузки статьи или частей статьи в различных форматах.

Открытые цитаты (ссылки для открытия цитат из этой статьи в различных онлайн-сервисах управления ссылками)

  • Менделей
  • ЧитатьКуб”>

Процитируйте эту статью (ссылки для загрузки цитат из этой статьи в форматах, совместимых с различными инструментами управления ссылками)

  1. Бенджамин Бонно
  2. Хидэаки Андо
  3. Кацухиро Кавааи
  4. Мацуми Хиросе
  5. Хироми Такахаши-Иванага
  6. Кацухико Микошиба

(2016)

IRBIT контролирует апоптоз, взаимодействуя с гомологом Bcl-2, Bcl2l10, и способствуя контакту ER-митохондрий

eLife 5 :e19896.

https://doi.org/10.7554/eLife.19896

  • Скачать БибТекс
  • Скачать .RIS
Категории и теги
  • Исследовательская статья
  • Клеточная биология
  • кальций
  • апоптоз
  • ИП3Р
  • Бкл-2
  • митохондриально-ассоциированные мембраны

Низкие уровни ИРБИТ связаны с химиорезистентностью у пациентов с раком желудка , ХИРОШИ САЭКИ и КЕН ШИРАБЕ

Противораковые исследования, август 2019 г., 39 (8) 4111-4116; DOI. Белок, связывающий рецептор 1,4,5-трифосфата, высвобождаемый с инозитол-1,4,5-трифосфатом (ИРБИТ) у пациентов с клиническим раком желудка (РЖ), может предсказать терапевтический ответ на послеоперационную адъювантную химиотерапию. Материалы и методы. Иммуногистохимию использовали для исследования экспрессии IRBIT у 115 пациентов с РЖ. Чтобы выяснить, имеет ли ИРБИТ связь с терапевтическими эффектами химиотерапии, мы сравнили две группы — 62 пациента, получавших послеоперационную адъювантную химиотерапию, и 53 пациента, получавших послеоперационную адъювантную химиотерапию. Результаты. Что касается группы послеоперационной адъювантной химиотерапии, мы не обнаружили статистически значимой корреляции между клинико-патологическими особенностями и рецидивами независимо от выраженности ИРБИТ. Напротив, в группе, получавшей послеоперационную адъювантную химиотерапию, была обнаружена значительная связь между экспрессией IRBIT и как общей, так и безрецидивной выживаемостью. Вывод: ИРБИТ можно использовать в качестве полезного прогностического маркера химиотерапии.

  • Белок, связывающий рецептор 1,4,5-трифосфата
  • ИРБИТ
  • рак желудка
  • химиорезистентность

Рак желудка (РЖ) — одно из наиболее частых злокачественных новообразований и третья по значимости причина смерти от злокачественных новообразований глобально (1). Тем не менее, клинический исход у пациентов с РЖ улучшился после лечебной резекции и послеоперационной адъювантной химиотерапии (2). Послеоперационная адъювантная химиотерапия способна улучшить выживаемость после операции; с другой стороны, остается недостаточным (3). Поэтому важно выявить предикторы терапевтического эффекта химиотерапии.

IRBIT (белок, связывающий инозитол-1,4,5-трифосфатный рецептор, высвобождаемый с инозитол-1,4,5-трифосфатом) был обнаружен как белок, связывающий инозитол-1,4,5-трифосфатный рецептор (IP3R) (4). IRBIT представляет собой многофункциональный белок, который регулирует активацию IP3R (5, 6), внутриклеточную концентрацию Ca 2+ (7), антиапоптотический белок BCL2L10 (8), ионные каналы и переносчики ионов, такие как Na + /HCO . 3 Котранспортер (9), Na 9теплообменник 0007 + /H + (10) и теплообменник Cl /HCO 3 (11). Функция IRBIT заключается в подавлении активации IP3R, что приводит к снижению индуцированных IP3 уровней Ca 2+ (5, 6). Внутриклеточная концентрация Ca 2+ в качестве вторичного мессенджера регулирует многие процессы, включая клеточный цикл и апоптоз (7). IRBIT способствует апоптозу, ингибируя BCL2L10 и способствуя контакту между эндоплазматическим ретикулумом и митохондриями (8), предполагая, что IRBIT является регулятором гибели клеток. Что касается рака, Чон и др. показали, что IRBIT действует как супрессор опухоли при эпителиальном раке яичников человека (12). Виттиг и др. показали, что IRBIT связан с лекарственной устойчивостью к препаратам, повреждающим ДНК, в клеточной линии злокачественной меланомы человека (13). Однако в нескольких исследованиях изучалась взаимосвязь между ИРБИТ и терапевтическими эффектами химиотерапии при РЖ.

S-1 представляет собой перорально активную комбинацию тегафура, гимерацила и отерацила в молярном соотношении 1:0,4:1 (14). Результаты крупномасштабного исследования, которое получило название «Испытание адъювантной химиотерапии S-1 при раке желудка» (ACTS-GC), показали, что пятилетняя общая выживаемость составила 71,7% в группе адъювантной терапии S-1 и 61,1% в группе адъювантной химиотерапии. группа только хирургического вмешательства (15, 16). S-1 был одобрен в качестве эффективной адъювантной химиотерапии у пациентов со II или III стадией РЖ, перенесших потенциально радикальное хирургическое вмешательство.

Цель этого исследования состояла в том, чтобы уточнить значение ИРБИТ у пациентов с клиническими проявлениями РЖ, особенно у пациентов, получавших послеоперационную адъювантную химиотерапию. Поэтому мы провели иммуногистохимический анализ для оценки экспрессии ИРБИТ в тканях РЖ.

Материалы и методы

Пациенты. В общей сложности было проспективно собрано 115 пациентов, перенесших потенциально излечивающую операцию в отделении общей хирургии университетской больницы Гунма в период с 2000 по 2006 год. Для выяснения, имеет ли ИРБИТ связь с терапевтическими эффектами химиотерапии, сравнивали две группы ГК – группу из 62 пациентов, не получавших послеоперационную адъювантную химиотерапию, и группу из 53 пациентов, получавших послеоперационную адъювантную химиотерапию. Характеристики пациентов в двух группах ГК с послеоперационной адъювантной химиотерапией и без нее показаны в Таблице 1. Причинами отказа от назначения послеоперационной адъювантной химиотерапии были пожилой возраст, общий статус (PS) в Восточной кооперативной онкологической группе (ECOG) три или четыре, сопутствующие заболевания и невозможность получить согласие. Средний возраст, пол, лимфатические метастазы и стадия TNM значительно различались между двумя группами ГК с послеоперационной адъювантной химиотерапией и без нее. В течение периода исследования в качестве послеоперационной адъювантной химиотерапии применялись следующие схемы: тридцать девять пациентов получали S-1, четыре случая получали 5-ФУ, по три случая получали УФТ (тегафур-урацил) и ФАП (5-ФУ плюс адриамицин плюс CDDP), два случая получали FP (5-FU плюс CDDP) и по одному случаю получали SP (S-1 плюс CDDP) и S-1 плюс паклитаксел. Послеоперационный патологоанатомический диагноз у всех пациентов был II или III стадии. Пациенты с РЖ были стадированы в соответствии с Японской классификацией рака желудка: 3-е английское издание, разработанной Японской ассоциацией рака желудка (17). Это исследование было одобрено институциональным наблюдательным советом Университета Гунма (утверждение № 180246).

Иммуногистохимия. Все образцы были разрезаны на срезы толщиной 4 μ мкм и помещены на предметные стекла. Все срезы депарафинизировали в ксилоле, регидратировали и инкубировали в течение 30 мин при комнатной температуре в 0,3% перекиси водорода для блокирования активности эндогенной пероксидазы. После регидратации с помощью поэтапной серии обработок этанолом извлечение антигена проводили в Immunosaver (Nishin EM, Токио, Япония) при 98-100°C в течение 45 мин. Сайты неспецифического связывания блокировали инкубацией с белковым блоком без сыворотки (DAKO, Burlingame, CA, USA) в течение 30 минут. Образцы инкубировали с первичными антителами (разбавленными разбавителем антител DAKO REAL) в течение ночи при 4°C. Использовали антитело к IRBIT (Proteintech Group Inc., Чикаго, Иллинойс, США, антитело Anti-AHCYL1, разведение 1:200). Набор Histofine Simple Stain MAX-PO (Multi) (Nichirei, Токио, Япония) использовали в качестве вторичного антитела. Хромоген 3,3-диаминобензидинтетрагидрохлорид наносили в виде 0,02% раствора в 50 мМ ацетатно-цитратно-кислом буфере аммония (рН 6,0), содержащем 0,005% перекиси водорода. Срезы слегка контрастировали гематоксилином и монтировали.

Срезы тканей были оценены двумя независимыми оценщиками, которые не знали данных пациентов. Мы сосредоточились на выражении ИРБИТ в раковых клетках и оценивали их по шкале Оллреда (18). Доля окрашенных клеток была разделена на шесть категорий (0: полностью отрицательные, 1: <1% положительных, 2: 1–10% положительных, 3: 11–33% положительных, 4: 34–66% положительных и 5: 67-100% положительных). Интенсивность наиболее преобладающей области была разделена на три категории (0: отсутствие окрашивания; 1: слабое положительное окрашивание; 2: умеренное положительное окрашивание; 3: сильное положительное окрашивание). Были добавлены показатели пропорции и интенсивности, а уровень отсечки составил ≥5 для группы с высокой экспрессией в этом исследовании.

Таблица I.

Характеристики 115 больных РЖ, разделенных на две группы: получавших (+) и не получавших (-) послеоперационную адъювантную химиотерапию.

Рис. 1.

Репрезентативные изображения иммуногистохимического окрашивания ИРБИТ тканями GC на поле при увеличении 200×. ( а ) экспрессия IRBIT была отрицательной в раковой ткани. (b) Экспрессия IRBIT была положительной в раковой ткани.

Рисунок 2.

Анализ Каплана-Мейера пятилетней (а) общей и (б) безрецидивной выживаемости в зависимости от экспрессии ИРБИТ у пациентов, не получавших послеоперационную адъювантную терапию; напротив, (c) общая и (d) безрецидивная выживаемость в зависимости от экспрессии IRBIT у пациентов, получавших послеоперационную химиотерапию.

Статистический анализ. Статистически значимые различия были проанализированы с использованием критерия Манна-Уитни U для непрерывных переменных и критерия хи-квадрат для категориальных переменных. Показатели выживаемости рассчитывали с использованием метода Каплана-Мейера, а статистическую значимость определяли с помощью логарифмического рангового теста. Однофакторный анализ выживаемости проводили с использованием модели пропорциональных рисков Кокса. Значение вероятности менее 0,05 считалось значимым. Все статистические анализы проводились с использованием программного обеспечения JMP Pro 12.0 (SAS Institute Inc., Кэри, Северная Каролина, США).

Результаты

Экспрессия ИРБИТ в клинических тканях РЖ. Иммуногистохимию использовали для исследования экспрессии IRBIT в 115 образцах ГК. Репрезентативные картины иммуногистохимического окрашивания показаны на рисунке 1. ИРБИТ был обнаружен в цитоплазме. Среди 115 пациентов с РЖ 26 (22,6%) были отнесены к группе с низким уровнем экспрессии IRBIT (рис. 1а), а 89 (77,4%) были отнесены к группе с высоким уровнем экспрессии IRBIT (рис. 1b).

Таблица II.

Взаимосвязь клинико-патологических факторов и экспрессии ИРБИТ в обеих группах больных РЖ, получавших в послеоперационном периоде адъювантную химиотерапию и не получавших ее.

Взаимосвязь между экспрессией IRBIT и клинико-патологическими особенностями пациентов с РЖ. Взаимосвязь между экспрессией ИРБИТ и клинико-патологическими особенностями у 115 пациентов с РЖ показана в таблице II. Что касается послеоперационной группы без адъювантной химиотерапии, не было обнаружено статистической значимости клинико-патологических особенностей. Также не было значительных ассоциаций между экспрессией IRBIT и общей выживаемостью, и выживаемостью без признаков заболевания, как показал анализ Каплана-Мейера (рис. 2а и б). Напротив, в группе, получавшей послеоперационную адъювантную химиотерапию, была обнаружена значительная связь между экспрессией IRBIT и общей выживаемостью (9).5361 p = 0,0072) и безрецидивная выживаемость ( p = 0,016) по анализу Каплана-Мейера (рис. 2c и d). Однако связь между экспрессией IRBIT и клинико-патологическими особенностями не была статистически значимой. При многофакторном анализе низкая экспрессия ИРБИТ в тканях РЖ была независимым прогностическим фактором плохой выживаемости (относительный риск = 3,37, 95% ДИ = 1,41-7,56, p = 0,0076), как и сосудистая инвазия при послеоперационной адъювантной химиотерапии. у 53 больных РЖ (табл. III).

Обсуждение

В этом исследовании мы продемонстрировали, что у пациентов с РЖ, получавших послеоперационную адъювантную химиотерапию, были связаны с рецидивами и неблагоприятным прогнозом, в зависимости от уровней экспрессии ИРБИТ. Более того, многомерный регрессионный анализ показал, что экспрессия IRBIT является независимым предиктором общей выживаемости.

Предыдущие исследования были сосредоточены на роли ИРБИТ в лекарственной устойчивости к препаратам, повреждающим ДНК (10). Бонно и др. показали, что IRBIT обладает сайтом связывания протеинфосфатазы-1 (8). Интересно, что протеинфосфатаза-1, как сообщалось, опосредует апоптоз посредством дефосфорилирования Akt (19) и белка ретинобластомы (20, 21). Эти данные свидетельствуют о том, что ИРБИТ является мишенью для протеинфосфатазы-1. В этом исследовании мы сравнили группу послеоперационной адъювантной химиотерапии с группой, получавшей послеоперационную адъювантную химиотерапию. Статистически значимой связи между клинико-патологическими особенностями и рецидивами обнаружено не было. Кроме того, неблагоприятный прогноз в послеоперационной группе без адъювантной химиотерапии зависел от экспрессии ИРБИТ. Однако была обнаружена значительная связь между экспрессией IRBIT и наличием рецидива и прогнозом в группе, получавшей послеоперационную адъювантную химиотерапию. Наши результаты показывают, что ИРБИТ участвует в резистентности к химиотерапии. Аналогично нашим результатам в GC, Jeong и др. показали, что IRBIT действует как супрессор опухоли при эпителиальном раке яичников человека (9). Следовательно, низкий IRBIT может быть предиктором более высокого риска рецидива РЖ у пациентов, получавших послеоперационную адъювантную химиотерапию.

Таблица III.

Результаты одномерного и многомерного анализа клинико-патологических факторов, влияющих на общую выживаемость после операций с послеоперационной адъювантной химиотерапией у 53 больных РЖ

Arnaoutov и Dasso показали, что нокдаун IRBIT приводит к вариабельности длины интерфазы и ускорению митотической прогрессии в клетках HeLa (22 ). Это открытие предполагает, что IRBIT контролирует ход клеточного цикла. Это исследование также предполагает возможность того, что регуляция рибонуклеотидредуктазы, которая поставляет строительные блоки, необходимые для синтеза и восстановления ДНК, контролирует стабильность генома и обеспечивает правильную регуляцию клеточного цикла с помощью IRBIT. В этом исследовании наиболее частыми послеоперационными схемами химиотерапии были S-1 и 5-FU. Тегафур, один из составных элементов S-1, является пролекарством 5-фторурацила (5-ФУ). 5-ФУ действует несколькими способами, но в основном как ингибитор тимидилатсинтазы. Вмешательство в действие этого фермента предотвращает синтез пиримидинтимидина, который является нуклеозидом, необходимым для репликации ДНК. Считалось, что и ИРБИТ, и 5-ФУ с S-1 связаны с репликацией ДНК. В свете этих открытий и наших результатов было сочтено, что экспрессия IRBIT может индуцировать эффект 5-FU с S-1. Кроме того, IRBIT будет иметь решающее значение для разработки персонализированных методов лечения пациентов на основе оценок рисков для пациентов.

Наше исследование имеет несколько ограничений. Во-первых, это исследование имеет небольшой размер выборки, что может привести к смещению результатов нашего исследования. Необходимы дальнейшие крупномасштабные клинические испытания, чтобы прояснить потенциал ИРБИТ как нового прогностического биомаркера для послеоперационной химиотерапии. Во-вторых, мы сравнили пациентов, не получавших послеоперационную адъювантную химиотерапию, с теми, кто ее получал. Недавно S-1 плюс оксалиплатин и капецитабин плюс оксалиплатин, а также S-1 были одобрены в качестве послеоперационной адъювантной химиотерапии для пациентов с РЖ. Таким образом, другие схемы послеоперационной адъювантной химиотерапии также нуждаются в оценке.

В заключение мы пояснили, что низкая экспрессия ИРБИТ в тканях РЖ, полученных от пациентов, получавших послеоперационную адъювантную химиотерапию, была связана с рецидивами и плохим прогнозом. ИРБИТ может быть полезен в качестве прогностического маркера химиотерапии.

Благодарности

Авторы благодарят г-жу Юкиэ Сайто, г-жу Саяку Окада, г-жу Каёко Такахаси, г-жу Мизуэ Мурата, г-жу Харуми Канаи, г-жу Фумиэ Такада, г-жу Сава Нагаяма и г-жу Марико. Накамура за отличную помощь.

Сноски

  • Вклад авторов

    Концепция и дизайн: Н. Наказава, К. Огата и Т. Йокобори; Сбор данных: Н. Наказава, С. Баатар, Ю. Убуката, А. Кимура и Н. Когуре; Анализ и интерпретация данных: Н. Наказава, К. Огата, Т. Йокобори, К. Ширабе; Написание, рецензирование и/или редактирование рукописи: Н. Наказава, К. Огата, Т. Йокобори, М. Сохда, Х. Кувано, Х. Саеки и К. Ширабе; Материальная поддержка: Иде М.; Руководители исследования: К. Огата, Т. Йокобори, М. Сохда, Х. Кувано, Х. Саэки и К. Ширабе. Все авторы читали и одобрили окончательный вариант рукописи.

  • Конфликт интересов

    Авторы заявляют об отсутствии конфликта интересов в отношении данного исследования.

  • Ревизия, полученная 14 июня 2019 года. ,
  • Ферле Дж.,
  • Лорте-Тьелан Дж.,
  • Джемал А
  • : Глобальная статистика рака, 2012. CA Cancer J Clin 65(2): 87-108, 2015. PMID: 25651787. DOI:10.3322/caac.21262

    1. Yamashita K,
    2. Sakuramoto S,
    3. Nemoto M,
    4. Shibata T,
    5. Mieno H,
    6. Katada N,
    7. Kikuchi S,
    8. Watanabe M

    : Trend при раке желудка: 35-летний хирургический опыт в Японии. Мир J Гастроэнтерол 17(29): 3390-3397, 2011. PMID: 21876631. DOI: 10.3748/wig.v17.i29.3390

    1. Cao J,
    2. Qi F,
    3. Liu T

    : Адъювантная химиотерапия после радикальной резекции рака желудка: метаанализ. Scand J Gastroenterol 49(6): 690-704, 2014. PMID: 24731211. DOI: 10.3109/00365521.2014.7

    1. Андо Х,
    2. Мизутани А,
    3. Мацу-ура Т,
    4. Mikoshiba K

    : IRBIT, новый белок, связывающийся с рецептором инозитол-1,4,5-трифосфата (IP3), высвобождается из рецептора IP3 при связывании IP3 с рецептором. J Biol Chem 278(12): 10602-10612, 2003. PMID: 12525476. DOI: 10.1074/jbc.M210119200

    1. Ando H,
    2. Mizutani A,
    3. Kiefer H,
    4. Tsuzurugi D,
    5. Michikawa T,
    6. Mikoshiba K

    : IRBIT подавляет активность рецептора IP3, конкурируя с IP3 за общий сайт связывания на рецепторе IP3. Mol Cell 22(6): 795-806, 2006. PMID: 167

  • . DOI: 10.1016/j.molcel.2006.05.017.

    1. Devogelaere B,
    2. Nadif Kasri N,
    3. Derua R,
    4. Waelkens E,
    5. Callewaert G,
    6. Missiaen L,
    7. Parys JB,
    8. De Smedt H

    : Связывание IRBIT с рецептором IP3: детерминанты и функциональные эффекты. Biochem Biophys Res Commun 343(1): 49-56, 2006. PMID: 16527252. DOI: 10.1016/j.bbrc.2006.02.119.

    1. Berridge MJ,
    2. Bootman MD,
    3. Roderick HL

    : Передача сигналов кальция: динамика, гомеостаз и ремоделирование. Nat Rev Mol Cell Biol 4(7): 517-529, 2003. PMID: 12838335. DOI: 10.1038/nrm1155.

    1. Бонно Б,
    2. Андо Х,
    3. Кавааи К,
    4. Hirose M,
    5. Takahashi-Iwanaga H,
    6. Mikoshiba K

    : IRBIT контролирует апоптоз, взаимодействуя с гомологом Bcl-2, Bcl2l10, и способствуя контакту ER-митохондрий. eLife 5: e19896, 2016. PMID: 279

  • . DOI: 10.7554/eLife.19896

    1. Ян Д,
    2. Щейников Н,
    3. Цзэн В,
    4. Охана Э,
    5. Со И,
    6. 5 А

      Миани Х,

      Андо Х,

    7. 0506
    8. Mikoshiba K,
    9. Muallem S

    : IRBIT координирует эпителиальную жидкость и секрецию HCO 3 , стимулируя транспортеры pNBC1 и CFTR в протоке поджелудочной железы мышей. J Clin Invest 119: 193-202, 2009. PMID: 1

    47. DOI: 10.1172/JCI36983.

    1. Lee SK,
    2. Boron WF,
    3. Parker MD

    : Облегчение аутоингибирования электрогенного Na/HCO 3 Котранспортер NBCe1-B: роль IRBIT по сравнению с укорочением амино-конца . Am J Physiol Cell Physiol 302(3): 518-526, 2012. PMID: 22012331. DOI: 10.1152/ajpcell.00352.2011.

    1. Hong JH,
    2. Yang D,
    3. Shcheynikov N,
    4. OHANA E,
    5. Shin DM,
    6. MUALLEM S
    9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105 9105

    . и киназы WNK/SPAK в регуляции Na + -HCO 3 семейство котранспортеров. Proc Natl Acad Sci USA 110(10): 4105-4110, 2013. PMID: 23431199. DOI: 10.1073/pnas. 1221410110

    1. Jeong W,
    2. Kim HS,
    3. Kim YB,
    4. Kim MA,
    5. Lim W,
    6. Kim J,
    7. Jang HJ,
    8. Suh DH,
    9. Kim K,
    10. Chung HH,
    11. Bazer FW,
    12. Song YS,
    13. Han JY,
    14. Song G

    : Парадоксальная экспрессия AHCYL1, влияющая на канцерогенез яичников у кур и женщин. Exp Biol Med (Maywood) 237(7): 758-767, 2012. PMID: 22826361. DOI: 10.1258/ebm.2012.011433

    1. Wittig R,
    2. Nessling M,
    3. Will RD,
    4. Mollenhauer J,
    5. Salowsky R,
    6. Münstermann E,
    7. Schick M,
    8. Helmbach H,
    9. Gschwendt B,
    10. Korn B,
    11. Kioschis P,
    12. Lichter P,
    13. Schadendorf D,
    14. Poustka A

    . Cancer Res 62(22): 6698-6705, 2002. PMID: 12438269.

    1. Ширасака Т,
    2. Симамато Ю,
    3. Ошимо Х,
    4. Ямагути М,
    5. Като Т,
    6. Ёнекура0506
    7. Fukushima M

    : Разработка новой формы перорального производного 5-фторурацила (S-1), направленного на потенцирование избирательной цитотоксичности 5-фторурацила в отношении опухоли двумя биохимическими модуляторами. Противораковые препараты 7(5): 548-557, 1996. PMID: 8862723.

    1. Сакурамото С,
    2. Сасако М,
    3. Ямагути Т,
    4. Киносита Т,
    5. Фуджи М,

      Насито А

      506

    6. Furukawa H,
    7. Nakajima T,
    8. Ohashi Y,
    9. Imamura H,
    10. Higashino M,
    11. Yamamura Y,
    12. Kurita A,
    13. Arai K,
    14. ACTS-GC Group

    : Адъювантная химиотерапия рака желудка с S-1, пероральным фторпиримидином. N Engl J Med 357(18): 1810-1820, 2007. PMID: 17978289. DOI: 10.1056/NEJMoa072252

    1. Сасако М.,
    2. Сакурамото С.,
    3. Katai H,
    4. Kinoshita T,
    5. Furukawa H,
    6. Yamaguchi T,
    7. Nashimoto A,
    8. Fujii M,
    9. Nakajima T,
    10. Ohashi Y

    : Five-year outcomes of a рандомизированное исследование фазы III, сравнивающее адъювантную химиотерапию с S-1 по сравнению с только хирургическим вмешательством при раке желудка стадии II или III. J Clin Oncol 29(33): 4387-4393, 2011. PMID: 22010012. DOI: 10.1200/JCO.2011.36.5908

    1. Японская ассоциация рака желудка

    : Японская классификация рака желудка: 3-е английское издание. Рак желудка 14: 101-112, 2011. PMID: 21573743. DOI: 10.1007/s10120-011-0041-5

    1. Allred D,
    2. Harvey JM,
    3. Berardo M,
    4. Clark GM

    : Прогностические факторы рака молочной железы и иммуногитохимический анализ. Mod Pathol 11(2): 155-168, 1998. PMID: 86.

    1. Thayyullathil F,
    2. Chathoth S,
    3. Shahin A,
    4. Kizhakkayil J,
    5. Hago A,
    6. Patel M,
    7. Galadari S

    : Protein phosphatase 1-dependent dephosphorylation Akt является первичным сигнальным событием при индуцированном сфингозином апоптозе в клетках Jurkat. J Cell Biochem 112(4): 1138-1153, 2011. PMID: 21308747. DOI: 10.1002/jcb.23033.

    1. Puntoni F,
    2. Villa-Moruzzi E

    : Активация протеинфосфатазы-1 и связь с белком ретинобластомы при колцемид-индуцированном апоптозе. Biochem Biophys Res Commun 266(1): 279-283, 1999. PMID: 10581203. DOI: 10.1006/bbrc.1999.1800

    1. Wang RH,
    2. Liu CW,
    3. Avramis VI,
    4. Berndt N

    : протеиновая фосфата, связанная с апопионом с апопт-апопт-апопт-апопт-апопт-апопт-апопт-апопт-апопт-апопт-апопт-апопионом. Oncogene 20(43): 6111-6122, 2001. PMID: 115

    . DOI: 10.1038/sj.onc.1204829

    1. Арнаутов А.,
    2. Дассо М.

    : Регуляция ферментов. ИРБИТ — новый регулятор рибонуклеотидредуктазы у высших эукариот. Science 345(6203): 1512-1515, 2014. PMID: 25237103. DOI: 10.1126/science.1251550

  • ПредыдущийСледующий

    Наверх

    SLC26A3 (DRA) СТИМУЛИРУЕТСЯ СИГНАЛАМИ CAMP И CA2+, И…. Библиотека DDW ePoster. Саркер Р. 21 мая 2021 г.; 319738

    Взаимодействуйте с докладчиком здесь во время сеанса электронного постера : Эпителиальная функция и поглощение ионов, воды и питательных веществ
    В пятницу, 21 мая 2021 г., с 12:15 до 13:00. EDT


    Номер: Fr588
    SLC26A3 (DRA) СТИМУЛИРУЕТСЯ И CAMP, И CA 2+ СИГНАЛИЗАЦИЯ, И ЭФФЕКТ ЯВЛЯЕТСЯ СИНЕРГИСТИЧЕСКИМ В ЭПИТЕЛИАЛЬНЫХ КЛЕТКАХ КИШЕЧНИКА В ПРОЦЕССЕ, КОТОРЫЙ ТРЕБУЕТ ИРБИТ.

    Общество: AGA
    Трек: Ожирение и питание
    Категория: Основные и клинические кишечные расстройства

    Автор (S): Rafiquel Sarker 1 , Varsha Singh 1 , Hong Yang 1 , Ruxian Lin 1 , Ming Tse 1 , Mark Donowitz 1 1 Medicine/GI/GI. , Медицинская школа Университета Джонса Хопкинса, Балтимор, Мэриленд, США

    Справочная информация: Множественные диарейные заболевания возникают, когда внутриклеточный сигнальный путь цАМФ и/или Ca 2+ усиливается такими агентами, как холерный токсин и ротавирус, соответственно. Кл /HCO 3 обменник SLC26A3 присутствует в больших количествах в подвздошной кишке и проксимальном отделе толстой кишки человека, где он присутствует в верхних криптах и ​​нижних ворсинках и поверхностных эпителиальных клетках вместе с NHE3 и CFTR. DRA участвует в абсорбции нейтрального NaCl в нормальных условиях и в секреции HCO 3 при секреторных диареях. сигнальные пути цАМФ и Ca 2+ синергизируют, регулируя многие физиологические функции. Белок, связывающий рецептор IP 3 , высвобождается с IP 9.0005 3 , IRBIT участвует в регуляции множества кишечных транспортных белков. Мы проверили гипотезу о том, что а) как повышенный уровень цАМФ, так и Ca 2+ изменяли активность DRA и что эти эффекты были синергическими в эпителиальных клетках кишечника, что способствовало пониманию патогенеза диарейных заболеваний; и б) что процесс зависит от ИРБИТ.
    Методы: клетки Caco-2 выращивали на полупроницаемых носителях в течение 14–20 дней, и было показано, что они содержат как CFTR, так и DRA. кл /HCO 3 обменную активность измеряли флуорометрически с использованием pHi-чувствительного красителя BCECF-AM и количественно определяли как внеклеточный Cl / 5% CO 2 , который может быть заблокирован специфическим ингибитором DRA, DRA inh -250.
    Результаты: В клетках Caco-2 как форсколин, так и АТФ резко стимулировали DRA зависимым от концентрации образом. Форсколин в концентрации 1,0 мМ и АТФ в концентрации 0,25 мМ оказывали минимальное влияние на активность DRA; однако их сочетание вызывало максимальную стимуляцию DRA. Нокаут IRBIT1 примерно на 85% с помощью Lentivirus-shRNA в клетках Caco-2 не изменил экспрессию DRA, но снизил активность DRA примерно на 50% по сравнению с клетками дикого типа. Клетки Caco-2/IRBIT1-KD потеряли эффект АТФ для стимуляции активности DRA, но сохранили эффект форсколина и устранили любое синергетическое взаимодействие АТФ и форсколина. Соосаждение Dra IRBIT1 незначительно увеличивалось при воздействии дозы FSK или АТФ, но значительно возрастало при низких концентрациях FSK плюс АТФ.
    Заключение: 1) Активность DRA стимулируется как цАМФ, так и повышенным содержанием Ca 2+ , и стимуляция синергична при низких концентрациях обоих. 2) Базальная, АТФ-стимулированная и АТФ- и форсколиновая синергетическая стимуляция активности DRA являются IRBIT-зависимыми, в то время как цАМФ-стимуляция DRA не является IRBIT-зависимой. 3) IRBIT физически ассоциируется с DRA, который синергетически усиливается при низком воздействии FSK и ATP. Мы предполагаем, что зависимые от ИРБИТ синергетические взаимодействия цАМФ и Ca 2+ систем при стимуляции АДР вносят вклад в патогенез секреторных диарейных заболеваний.

    Взаимодействуйте с докладчиком здесь во время сеанса электронного постера : Эпителиальная функция и поглощение ионов, воды и питательных веществ
    В пятницу, 21 мая 2021 г. , с 12:15 до 13:00. EDT


    Номер: Fr588
    SLC26A3 (DRA) СТИМУЛИРУЕТСЯ И CAMP, И CA 2+ СИГНАЛИЗАЦИЯ, И ЭФФЕКТ ЯВЛЯЕТСЯ СИНЕРГИСТИЧЕСКИМ В ЭПИТЕЛИАЛЬНЫХ КЛЕТКАХ КИШЕЧНИКА В ПРОЦЕССЕ, КОТОРЫЙ ТРЕБУЕТ ИРБИТ.

    Society: AGA
    Track: Obesity and Nutrition
    Category: Basic & Clinical Intestinal Disorders

    Author(s): Rafiquel Sarker 1 , Varsha Singh 1 , Hong Yang 1 , Ruxian Lin 1 , Ming Tse 1 , Mark Donowitz 1 1 Medicine/GI, Медицинская школа Университета Джонса Хопкинса, Балтимор, Мэриленд, США

    Справочная информация: Множественные диарейные заболевания возникают при внутриклеточном цАМФ и/или Ca 9Передача сигналов 0007 2+ усиливается такими агентами, как холерный токсин и ротавирус, соответственно. Обменник Cl /HCO 3 SLC26A3 присутствует в больших количествах в подвздошной кишке и проксимальном отделе толстой кишки человека, где он присутствует в верхних криптах и ​​нижних ворсинках и поверхностных эпителиальных клетках вместе с NHE3 и CFTR. DRA участвует в абсорбции нейтрального NaCl в нормальных условиях и в секреции HCO 3 при секреторных диареях. сигнальные пути цАМФ и Ca 2+ синергизируют, регулируя многие физиологические функции. ИС 3 рецептор-связывающий белок, высвобождаемый с IP 3 , IRBIT участвует в регуляции множества кишечных транспортных белков. Мы проверили гипотезу о том, что а) как повышенный уровень цАМФ, так и Ca 2+ изменяли активность DRA и что эти эффекты были синергическими в эпителиальных клетках кишечника, что способствовало пониманию патогенеза диарейных заболеваний; и б) что процесс зависит от ИРБИТ.
    Методы: клетки Caco-2 выращивали на полупроницаемых носителях в течение 14–20 дней, и было показано, что они содержат как CFTR, так и DRA. кл /HCO 3 обменную активность измеряли флуорометрически с использованием pHi-чувствительного красителя BCECF-AM и количественно определяли как внеклеточный Cl / 5% CO 2 , который может быть заблокирован специфическим ингибитором DRA, DRA inh -250.
    Результаты: В клетках Caco-2 как форсколин, так и АТФ резко стимулировали DRA зависимым от концентрации образом. Форсколин в концентрации 1,0 мМ и АТФ в концентрации 0,25 мМ оказывали минимальное влияние на активность DRA; однако их сочетание вызывало максимальную стимуляцию DRA. Нокаут IRBIT1 примерно на 85% с помощью Lentivirus-shRNA в клетках Caco-2 не изменил экспрессию DRA, но снизил активность DRA примерно на 50% по сравнению с клетками дикого типа. Клетки Caco-2/IRBIT1-KD потеряли эффект АТФ для стимуляции активности DRA, но сохранили эффект форсколина и устранили любое синергетическое взаимодействие АТФ и форсколина. Соосаждение Dra IRBIT1 незначительно увеличивалось при воздействии дозы FSK или АТФ, но значительно возрастало при низких концентрациях FSK плюс АТФ.
    Заключение: 1) Активность DRA стимулируется как цАМФ, так и повышенным содержанием Ca 2+ , и стимуляция синергична при низких концентрациях обоих. 2) Базальная, АТФ-стимулированная и АТФ- и форсколиновая синергетическая стимуляция активности DRA являются IRBIT-зависимыми, в то время как цАМФ-стимуляция DRA не является IRBIT-зависимой. 3) IRBIT физически ассоциируется с DRA, который синергетически усиливается при низком воздействии FSK и ATP. Мы предполагаем, что зависимые от ИРБИТ синергетические взаимодействия цАМФ и Ca 2+ систем при стимуляции АДР вносят вклад в патогенез секреторных диарейных заболеваний.

    Протеинфосфатаза-1 – новый регулятор взаимодействия между ИРБИТ и рецептором инозитол-1,4,5-трифосфата | Биохимический журнал

    Пропустить пункт назначения

    Исследовательская статья| 25 сентября 2007 г.

    Бенуа Девогелэр;

    Моник Белленс;

    Ева Саммелс;

    Рита Деруа;

    Этьен Велкенс;

    Йохан ван Линт;

    Ян Б. Парис;

    Людвиг Миссиен;

    Матье Боллен;

    Гумберт Де Смедт

    Biochem J (2007) 407 (2): 303–311.

    https://doi.org/10.1042/BJ20070361

    История статьи

    Получен:

    март 15 2007 г.

    Полученная ревизия:

    29 июня 2007 г.

    Принято:

    18 июля 2007 г.

    Принятая рукопись онлайн:

    18 июля 2007 г.

    • Просмотры
      • Содержание артикула
      • Рисунки и таблицы
      • Видео
      • Аудио
      • Дополнительные данные
      • Экспертная оценка
    • Делиться
      • MailTo
      • Твиттер
      • LinkedIn
    • Иконка Цитировать Цитировать

    • Получить разрешения

    Citation

    Бенуа Девогелэр, Моник Белленс, Ева Саммелс, Рита Деруа, Этьен Велкенс, Йохан ван Линт, Ян Б. Пэрис, Людвиг Миссиен, Матье Боллен, Умбер Де Смедт; Протеинфосфатаза-1 является новым регулятором взаимодействия между IRBIT и инозитол-1,4,5-трифосфатным рецептором. Biochem J 15 октября 2007 г.; 407 (2): 303–311. doi: https://doi.org/10.1042/BJ20070361

    Скачать файл цитирования:

    • Рис (Зотеро)
    • Менеджер ссылок
    • EasyBib
    • Подставки для книг
    • Менделей
    • Бумаги
    • Конечная примечание
    • RefWorks
    • Бибтекс
    панель инструментов поиск

    Расширенный поиск

    IRBIT представляет собой IP 3 R [IP 3 (инозитол-1,4,5-трифосфат) рецептор]-связывающий белок, который конкурирует с IP 3 за связывание с IP 3 R. Фосфорилирование IRBIT необходим для взаимодействия с IP 3 R. Уникальная N-концевая область IRBIT, остатки 1–104 для мышиного IRBIT, содержит домен PEST (Pro-Glu-Ser-Thr) со многими предполагаемыми сайтами фосфорилирования. В настоящем исследовании мы идентифицировали хорошо консервативный сайт связывания PP1 (протеинфосфатаза-1), предшествующий этому домену PEST, который позволил связывать PP1 с IRBIT как in vitro и in vivo . IRBIT возник как медиатор собственного дефосфорилирования ассоциированным PP1 и, следовательно, как новый спецификатор субстрата для PP1. Кроме того, IRBIT-ассоциированный PP1 специфически дефосфорилирует Ser 68 IRBIT. Фосфорилирование Ser 68 было необходимо для последующего фосфорилирования Ser 71 и Ser 74 , но последние два сайта не были нацелены на PP1. Мы обнаружили, что фосфорилирование Ser 71 и Ser 74 было достаточно для ингибирования связывания IP 3 с IP 3 R с помощью IRBIT. Наконец, мы показали, что мутационная инактивация сайта стыковки для PP1 на IRBIT увеличивает сродство IRBIT к IP 3 R. Это указывает на то, что PP1 является ключевым игроком в регуляции IP 3 R-контролируемого Ca 2.

Добавить комментарий

Ваш адрес email не будет опубликован.