Впр фипи: ФГБНУ «ФИПИ»

Содержание

Официальный сайт ВПР 2020 - ФИОКО, ФИПИ

Официальный сайт ВПР 2020 для 4, 5, 6, 7, 8 классов - сайт института оценки качества образования ФИОКО.

Здесь размещены демонстрационные задания с ответами и критериями оценивания, различная информация о ВПР: план графики, порядок проведения, официальные документы и др.

Официальный сайт ВПР  (СтатГрад) - www.eduvpr.ru - осуществлял информационное сопровождение всероссийских проверочных работ под руководством  Рособрнадзора в период с 2015 - 2018 год.

Здесь, пока можно найти материалы прошлых лет: образцы, описания и д.т.

На сайте ФИОКО размещена информация для 4, 5, 6, 7, 8 классов.

Задания ВПР для 11 классов размещены на сайте ФИПИ.

Официальный сайт Рособрнадзор - obrnadzor.gov.ru 

Это управляющая структура, осуществляет общее управление, контролем учебных заведений.

Здесь в первую очередь появляются новости, связанные с проведением проверочных работ, ОГЭ и ЕГЭ.

В 2020 году ВПР для 4, 5, 6, 7 классов проводятся в обязательном порядке.

Для 8 классов ВПР в 2020 году пройдут первый раз в режиме апробации.

В 11 классах ВПР проводятся для обучающихся, не выбравших ЕГЭ по соответствующим предметам. Они дают возможность оценить уровень подготовки обучающихся по этим предметам в конце 11 (или 10) класса.

В отличие от других оценочных процедур (ЕГЭ, ГИА и пр.), проверку ВПР осуществляет сама школа: дети написали, учителя собрали, сели и внутри своего коллектива обсудили все ошибки, успехи, пробелы. Это важная часть системной работы учителей, и стандартизированные работы – колоссальный материал для них.

Затем результаты в виде баллов "поднимаются" на все уровни ‒ муниципальный, региональный, федеральный. Результаты анализируются. Никаких организационных выводов из разряда "плохая школа" или "хорошая школа" никто не делает и делать не собирается.

Фиксируются глобальные тенденции. Они связаны не с предметным обучением, а в большей степени с общими особенностями для разных предметов.

Например, сейчас мы видна тенденция, что после 4 класса результаты школьников резко падают.

Безусловно, на это влияют особенности переходного возраста пятиклассников, шестиклассников и семиклассников. Но задача педагогики как раз состоит в том, чтобы купировать проблемы, централизованно помочь школе с ними справиться.

Цитата из интервью корреспонденту РИА Новости директора Федерального института оценки качества образования Сергея Станченко.

"Поставьте отметку!"

‒ Последнее время многие эксперты выступают за безотметочное обучение, поскольку полагают, что любая отметка ‒ стресс для ребенка. На Ваш взгляд, проведение контрольных работ не расшатывает психику российских школьников?

 ‒ Я совершенно не согласен с такими экспертами. Отметка – это мотивация. Первый год, когда мы ввели ВПР, Рособрнадзор рекомендовал не ставить отметки по результатам работ. Вы себе не представляете, сколько возмущенных писем от школ мы получили! Дети написали работу, они хотят знать, что за нее получили.

Оценка должна быть. Человек, который готовится к будущей взрослой жизни, должен хоть иногда выходить из зоны комфорта и погружать себя в состояние стресса. Надо учиться и творить, и заниматься рутинным трудом, проходить испытания ‒ все это неотъемлемая часть обучения.

Смотрите также:

4ВПР | Всероссийские проверочные работы 2022

Рособрнадзор утвердил расписание проведения всероссийских проверочных работ (ВПР) в 2022 году. Федеральный институт оценки качества образования опубликовал образцы проверочных работ для обучающихся по программам СПО. Рособрнадзор представил демонстрационные варианты Всероссийской проверочной работы на 2021 год. Учителям не следует "натаскивать" школьников на всероссийские проверочные работы, которые призваны оценить реальные знания учеников и состояние дел в субъекте, заявил глава Рособрнадзора Анзор Музаев на пресс-конференции в ТАСС. Полное руководство по выполнению работы, а также исчерпывающее объяснение по каждой из задач ВПР по русскому языку за 8 класс. История России. Всероссийские проверочные работы планируется перевести в компьютерный формат сдачи в ближайшие два года, сообщил глава Рособрнадзора Анзор Музаев. Разбор всех заданий новой демоверсии ВПР-8 по химии. Депутат Госдумы Елена Строкова предложила отменить Всероссийские проверочные работы, которые с марта по май должны писать школьники 4, 5, 6 и 11-го классов, сообщает издание RT. Всероссийские проверочные работы впервые пройдут в техникумах и колледжах с 15 сентября по 20 октября 2021 года.
ВПР для обучающихся СПО в 2021/22 учебном году проводятся впервые. Они будут проведены с 15 сентября по 9 октября во всех образовательных организациях, реализующих программы среднего профессионального образования. 1 марта в российских школах начинается проведение всероссийских проверочных работ. В 2021 году они пройдут для обучающихся 4-8 классов в штатном режиме, для обучающихся 11 классов – по решению школы. Всего в написании ВПР примут участие более 7 миллионов школьников. Отказ от ВПР не планируется, это всего лишь одна из контрольных работ, регулярно проводимых в каждой школе, рассказали РИА Новости в пресс-службе ведомства. Образец проверочной работы для четвероклассников на 2021 год.
Образец проверочной работы для четвероклассников на 2021 год.

ФИОКО - ВПР

Образцы и описания проверочных работ для проведения ВПР в 2019 году

Образцы и описания проверочных работ для проведения ВПР в 2020 году

Образцы и описания проверочных работ для проведения ВПР в 2021 году

Методические рекомендации по проведению Всероссийских проверочных работ

Всероссийские проверочные работы (ВПР) – это комплексный проект в области оценки качества образования, направленный на развитие единого образовательного пространства в Российской Федерации, мониторинг введения Федеральных государственных образовательных стандартов (ФГОС), формирование единых ориентиров в оценке результатов обучения, единых стандартизированных подходов к оцениванию образовательных достижений обучающихся.

Указанные цели достигаются за счет проведения ВПР в единое время по единым комплектам заданий, а также за счет использования единых для всей страны критериев оценивания.

В 2019 году участие в ВПР для 4, 5, 6 классов было обязательным, для 7 и 11 классов – по решению школы.

План-график проведения ВПР 2019

Проект расписания ВПР на 2020 год

Приказ Рособрнадзора от 11.02.2021 №119 "О проведении Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в форме всероссийских проверочных работ в 2021 году" (с письмом от 12.02.2021 №14-15)

План-график проведения всероссийских проверочных работ в 2021 году

Порядок проведения ВПР в 2021 году

Письмо Рособрнадзора №14-22 от 25.02.2021 о проведении ВПР для обучающихся по образовательным программам СПО в 2021 году

Приказ Рособрнадзора от 27.12.2019 №1746 "О проведении Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в форме всероссийских проверочных работ в 2020 году"

Приказ Рособрнадзора от 07. 02.2019 № 104 "О внесении изменений в график проведения Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в форме национальных исследований качества образования и всероссийских проверочных работ в 2019 году, утвержденный приказом Федеральной службы по надзору в сфере образования и науки от 29 января 2019 г. № 84 "О проведении Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в 2019 году"

Письмо Минпросвещения России и Рособрнадзора от 06.02.2019 № 01-68/13-01 "О направлении скорректированного плана-графика проведения всероссийских проверочных работ (ВПР) и национальных исследования качества образования (НИКО) в 2019 году" 

Приказ Рособрнадзора от 29.01.2019 № 84 "О проведении мониторинга качества образования в 2019 году"

Письмо Минпросвещения России и Рособрнадзора от 25.01.2019 № 01-48/13-01 "О направлении примерного плана-графика всероссийских проверочных работ (ВПР) и национальных исследований качества образования (НИКО) в 2019 году"

ВПР 2019.

Список образовательных организаций с признаками необъективных результатов

ВПР 2018. Список образовательных организаций с признаками необъективных результатов

Рекомендации по повышению объективности оценки образовательных результатов

 ________________________________________________________________________________

Вебинар по использованию банка оценочных средств для проведения ВПР ОО 26/11/2019

Вебинар по использованию банка оценочных средств для проведения ВПР специалистами, осуществляющими ФГККО 27/11/2019

ВПР

На основании   Приказа Федеральной службы по надзору в сфере образования и науки от 11.02.21 № 119 0 проведении Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в форме Всероссийских проверочных работ в 2021 году.

ВПР в 11 классе по каждому из представленных предметов выполняют обучающиеся, которые не выбирают данные предметы при прохождении ГИА по образовательным программам СОО в форме ЕГЭ.

Дата

Предмет

Время работы

Класс

1

3.03.21

История России

90 минут

11 а, 11 б

2

5.03.21

Английский язык

65 минут

11 а

3

9.03.21

Английский язык

65 минут

11 б

4

10.03.21

Химия

90 минут

11 а

5

12. 03.21

Физика

90 минут

11б

6

16.03.21

Биология

90 минут

11 а

(приказ Рособрнадзора от 11.02.2021 № 119).

График проведения ВПР-2021 в МБОУ «Лицей №62»

Дата

Параллель

Предмет

Формат

19,20 апреля

22 апреля

15 апреля

4-е

Русский язык
Математика
Окружающий мир

В штатном режиме.

ВПР по конкретному предмету проводятся во всех классах данной параллели

8 апреля

15 апреля

20 апреля

23 апреля

5-е

Русский язык
Математика
Биология
История

6 апреля

9 апреля

6-е

Русский язык
Математика

13 апреля

5 апреля

20 апреля

15 апреля

7 апреля

9 апреля

12 апреля

7-е

Русский язык
Математика
История
Биология
География
Обществознание
физика

21,22,23,26,27 апреля

7-е

Английский язык
Французский язык
Немецкий язык

14 апреля

16 апреля

8-е

Русский язык
Математика

13 апреля

16 апреля

6-е

История
Биология
География
Обществознание

В штатном режиме.

ВПР в параллели 6-х и 8-х классов проводятся для каждого класса по двум предметам на основе случайного выбора. Информация о распределении предметов по классам в параллели предоставляется в ОО через личный кабинет в ФИС ОКО

19 апреля

22 апреля

8-е

История
Биология
География
Обществознание
Физика
Химия

В режиме апробации

3 марта

16 марта

-

12 марта

10 марта

5,9 марта

11-е

История
Биология
География
Физика
Химия
Английский язык
Французский язык
Немецкий язык

 

Участие в Диагностическом тестировании ЕГЭ

Диагностическое тестирование проводится строго на добровольной основе. Участвовать в диагностическом тестировании могут учащиеся  10, 11 классов и выпускники прошлых лет.

Сроки проведения диагностического тестирования в 2020-2021 учебном году:

Дата проведения

Диагностическое тестирование по общеобразовательным предметам 11 класс, ЕГЭ

22 марта 2021 года в 10.00

Русский язык

23 марта 2021 года в 10.00

География

Резервный день: по всем предметам

24 марта 2021 года в 10.00

Физика

Литература

25 марта 2021 года в 10.00

История

Химия

26 марта 2020 года в 10.00

Биология

Английский/немецкий (письменная часть)

29 марта 2021 года в 10. 00 

Обществознание

30 марта 2021 в 10.00

Математика (проф.)

Приказ Рособрнадзора от 27. 12.2019 №1746 "О проведении Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в форме всероссийских проверочных работ в 2020 году"

Информационное и технологическое сопровождение подготовки и проведения ВПР осуществляется на сайте www.eduvpr.ru
Еще один информационный ресурс с заданиями ВПР это сайт ФИПИ  http://wap.fipi.ru/vpr.  «Федеральный институт педагогических измерений».  Здесь информация только для 11 классов.  
Всероссийские проверочные работы - это итоговые контрольные работы, проводимые по отдельным учебным предметам для оценки уровня подготовки школьников с учетом требований Федерального государственного образовательного стандарта. Результаты ВПР могут использоваться для формирования программ развития образования в муниципалитетах, регионах и в целом по стране, для совершенствования методики преподавания предметов в конкретных школах, а также для индивидуальной работы с учащимися по устранению имеющихся пробелов в знаниях. Работы выполняются по заданиям, разработанным на федеральном уровне, и проверяются по единым критериям.  
Официальный сайт ВПР (СтатГрад) - www.eduvpr.ru- осуществляет информационное сопровождение ВПР по указанию Рособрнадзор. Здесь размещены демонстрационные задания и ответы, различная информация о ВПР: план графики, порядок проведения и др. 
Официальный сайт Рособрнадзор - http://obrnadzor.gov.ru (МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ ФЕДЕРАЛЬНАЯ  СЛУЖБА ПО НАДЗОРУ В СФЕРЕ ОБРАЗОВАНИЯ И НАУКИ РОСОБРНАДЗОР) Это управляющая структура, осуществляет общее управление, контролем учебных заведений.

Письмо Министерства просвещения Российской Федерации от 25 января 2019 г. № ОВ-56/04 и письму Федеральной службы по надзору в сфере образования и науки от 25 января 2019 г. № 01-48/13-01 
Обновленное расписание ВПР-2019Письмо Минпросвещения, Рособрнадзора от 06.02.2019 № ОВ-127/04, 01-68/13-01

Приказ №84  "О проведении Федеральной службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в 2019 году

Письмо Федеральной службы по надзору в сфере образования и науки (Рособрнадзор) от  17. 01.2018 N 05-11 «Всероссийские проверочные работы - 2018»

ВПР 2018-2019 учебного года

Приказ Минобрнауки от 20 октября 2017г. №1025

Образцы ВПР 4 класс 2018 год - математика, русский язык, окружающий мир

Муниципальное бюджетное общеобразовательное учреждение «Центр образования № 15 «Луч» города Белгорода

Федеральная служба по надзору в сфере образования и науки в соответствии с поручением Министерства образования и науки Российской Федерации проводит Всероссийские проверочные работы (ВПР).

Основная цель проведения ВПР – получение информации об уровне индивидуальных образовательных достижений школьников в соответствии с федеральными государственными образовательными стандартами.

Варианты ВПР составлены в формулировках, принятых в учебниках из федерального перечня, задания содержат наиболее значимые и важные для подготовки учащихся элементы по каждому учебному предмету. Не используются задания с выбором ответа из готовых вариантов. Демонстрационные версии ВПР  размещены на информационном портале ВПР: www.eduvpr.ru и на сайте ФИПИ: http://wap.fipi.ru/vpr.

Всероссийские проверочные работы учащиеся пишут в своих школах. Рекомендуемое время их проведения – второй-третий урок; продолжительность – от одного до двух уроков. Проверка работ участников ВПР осуществляется в день проведения работы коллегиально учителями школы.

Федеральная служба по надзору в сфере образования подчеркивает, что ВПР не являются государственной итоговой аттестацией. По результатам ВПР не принимаются никакие обязательные решения, важные для определения дальнейшей судьбы или образовательной траектории школьника. Эти результаты не влияют на получение аттестата или на перевод в следующий класс.

Для родителей информация о результатах выполнения ВПР может оказаться важной и интересной потому, что будет являться информацией о результатах в целом по школе, в которой учится их ребенок. Поскольку ВПР проводятся по единым заданиям и оцениваются по единым для всей страны критериям, это позволит увидеть результаты школы на фоне общей картины по стране.

Помимо этого, ВПР позволят осуществлять мониторинг результатов введения Федеральных государственных образовательных стандартов, а также послужат развитию единого образовательного пространства в Российской Федерации.


Расписание ВСЕРОССИЙСКИХ ПРОВЕРОЧНЫХ РАБОТ на 2021 МБОУ ЦО №15 "Луч" г.Белгорода

Федеральной службой по надзору в сфере образования и науки подготовлена информационная брошюра о НИКО и ВПР для учащихся и их родителей. Из нее можно узнать, как проводятся эти оценочные процедуры, для чего используются их результаты, какие выводы стоит сделать из них родителям и педагогам, чтобы оптимальным образом выстроить образовательную траекторию ребенка.


ДОКУМЕНТЫ
ФЕДЕРАЛЬНЫЙ УРОВЕНЬ
РЕГИОНАЛЬНЫЙ УРОВЕНЬ
МУНИЦИПАЛЬНЫЙ УРОВЕНЬ
ШКОЛЬНЫЙ УРОВЕНЬ
Образцы и описания проверочных работ для проведения ВПР в 2021 году

Ошибка 404 — Страница не найдена

К сожалению мы не можем показать то, что вы искали. Может быть, попробуете поиск по сайту или одну из приведенных ниже ссылок?

Архивы Выберите месяц Август 2021 Июль 2021 Июнь 2021 Май 2021 Апрель 2021 Март 2021 Февраль 2021 Январь 2021 Декабрь 2020 Ноябрь 2020 Октябрь 2020 Сентябрь 2020 Август 2020 Июль 2020 Июнь 2020 Май 2020 Апрель 2020 Март 2020 Февраль 2020 Январь 2020 Декабрь 2019 Ноябрь 2019 Октябрь 2019 Сентябрь 2019 Август 2019 Июль 2019 Июнь 2019 Май 2019 Апрель 2019 Март 2019 Февраль 2019 Январь 2019 Декабрь 2018 Ноябрь 2018 Октябрь 2018 Сентябрь 2018 Август 2018 Июль 2018 Июнь 2018 Февраль 2018 Январь 2018 Ноябрь 2017 Сентябрь 2017 Август 2017 Июль 2017 Апрель 2017 Март 2017 Февраль 2017 Январь 2017

РубрикиВыберите рубрикуbritish bulldogАстраБез рубрикиВидеоурокиВОШдвизолотое руноКенгуруКИТконкурс ПегасОВИООтветы на работы СтатГрадРДРРешу ЕГЭрусский медвежонокСочинениеСтатьиУчебные пособияЧИП

  • 04.10.2020 XLIII Турнир Ломоносова задания и ответы
  • 05. 12.17 Ответы и задания по математике 10 класс СтатГрад варианты МА00201-МА00208
  • 05.12.17 Ответы и задания по математике 7 класс «СтатГрад» варианты МА70101-МА70106
  • 06.11.2017 Олимпиада «Звезда» естественные науки задания и ответы 6-11 класс отборочный этап
  • 06.12.17 Официальные темы итогового сочинения 2017 для Камчатского края и Чукотского автономного округа
  • 06.12.17 Официальные темы итогового сочинения 2017 для Республика Алтай, Алтайский край, Республика Тыва, Респ. Хакасия, Красноярский край, Кемеровская, Томская и Новосибирская область
  • 06.12.17 Официальные темы итогового сочинения 2017 зона 8 Республика Саха (Якутия), город Якутск, Амурская область, Забайкальский край
  • 06.12.17 Официальные темы итогового сочинения для Республика Бурятия, Иркутская область зона 7
  • 06.12.2017 5 зона Омск MSK+3 (UTC+6) официальные темы
  • 06.12.2017 Ответы и задания по обществознанию 9 класс «СтатГрад» варианты ОБ90201-ОБ90204
  • 07. 12.17 Ответы и задания по русскому языку 11 класс СтатГрад варианты РЯ10701-РЯ10702
  • 07.12.2017 Ответы и задания по биологии 9 класс пробное ОГЭ 4 варианта
  • 08.12.2017 Ответы и задания по географии 9 класс контрольная работа ОГЭ 56 регион
  • 08.12.2017 Ответы и задания по физике 9 класс работа СтатГрад ОГЭ ФИ90201-ФИ90204
  • 10.04.2020 Решать впр тренировочные варианты по математике 6 класс с ответами
  • 10.10.17 Математика 9 класс контрольная работа 4 варианта ФГОС 56 регион задания и ответы
  • 10.10.17 Русский язык 9 класс задания и ответы «СтатГрад» варианты РЯ90101-РЯ90102
  • 10.11.2017 История 9 класс задания и ответы статград варианты ИС90201-ИС90204
  • 100balnik мы в ВКОНТАКТЕ
  • 100balnik отзывы пользователей
  • 11 апреля 10-11 класс география ответы и задания
  • 11 апреля 6 класс история ответы и задания
  • 11 апреля 7 класс биология ответы и задания
  • 11.04.2020 Решать ВПР тренировочные варианты по математике 5 класс с ответами
  • 11. 10.17 Физика 11 класс СтатГрад задания и ответы варианты ФИ10101-ФИ10104
  • 11.12.2017 — 16.12.2017 Олимпиада по дискретной математике и теоретической информатике
  • 11.12.2017 Зимняя олимпиада по окружающему миру для 4 класса задания и ответы
  • 11.12.2017 Ответы и задания по английскому языку 11 класс СтатГрад вариант АЯ10101
  • 11.12.2017 Соревнование для 5-6 классов интернет-карусель по математике задания и ответы
  • 12.04.2020 Решать тренировочные варианты ВПР по математике 4 класс + ответы
  • 12.10 Русский язык 10 класс диагностическая работа ФГОС для 11 региона задания и ответы
  • 12.10.17 Русский 2 класс ВПР официальные варианты задания и ответы
  • 12.10.17 Химия 9 класс «СтатГрад» задания и ответы варианты ХИ90101-ХИ90104
  • 12.12.2017 Ответы и задания по географии 9 класс работа СтатГрад варианты ГГ90101-ГГ90102
  • 13.09.2017 Биология 11 класс СтатГрад задания и ответы все варианты
  • 13.10.17 Математика 9 класс задания и ответы для 11 региона
  • 13. 10.2017 Обществознание 11 класс работа СтатГрад задания и ответы ОБ10101-ОБ10104
  • 13.12.2017 Ответы по физике 11 класс статград задания варианты ФИ10201-ФИ10204
  • 13.12.2017 Письмо говорение по английскому языку 7-9 класс работа 56 регион
  • 14.09.2017 Информатика 11 класс тренировочная работа статград ответы и задания
  • 14.12 Геометрия 9 класс задания и ответы «СтатГрад»
  • 14.12.2017 КДР ответы по русскому языку 8 класс задания все варианты
  • 14.12.2017 Контрольная работа по математике 8 класс за 1 полугодие 2 варианта заданий с ответами
  • 14.12.2017 Литература 11 класс ответы и задания СтатГрад вариант ЛИ10101
  • 14.12.2017 Ответы КДР по математике 10 класс задания 6 вариантов
  • 14.12.2017 Ответы по геометрии 9 класс СтатГрад задания варианты МА90301-МА90304
  • 14.12.2017 Ответы по математике 11 класс КДР задания 6 вариантов
  • 15.09 Математика 10 класс контрольная работа 3 варианта 56 регион задания и ответы
  • 15. 09.2017 Биология 9 класс тренировочная работа «СтатГрад» БИ90101-БИ90104 ответы и задания
  • 15.11.2017 Задания и ответы 2-11 класс по Русскому медвежонку 2017 год
  • 15.12.2017 Обществознание 11 класс ответы и задания СтатГрад варианты ОБ10201-ОБ10204
  • 16 апреля 11 класс английский язык ответы и задания
  • 16 апреля 5 класс история ответы и задания
  • 16 апреля 6 класс биология ответы и задания
  • 16 апреля 7 класс география ответы и задания
  • 16.01.2018 Контрольная работа по русскому языку 9 класс в формате ОГЭ с ответами
  • 16.01.2018 Ответы и задания КДР по русскому языку 11 класс 23 регион
  • 16.10.2017 Ответы и задания всероссийской олимпиады школьников по математике 4-11 класс ВОШ
  • 16.11.2017 МЦКО 10 класс русский язык ответы и задания
  • 17.01.2018 Ответы и задания по информатике 11 класс работа статград варианты ИН10301-ИН10304
  • 17.10.17 Физика 9 класс «СтатГрад» задания и ответы варианты ФИ90101-ФИ90104
  • 18 апреля 11 класс химия ответы и задания
  • 18 апреля 5 класс биология ответы и задания
  • 18 апреля 6 класс обществознание ответы и задания
  • 18 апреля 7 класс математика ответы и задания
  • 18. 09. Математика 10 класс задания и ответы
  • 18.10.17 Математика 9 класс РПР 64 регион задания и ответы 1 этап
  • 18.10.2017 Задания и ответы по математике 9 класс 50 регион Московская область
  • 18.12.2017 Биология 11 класс Статград задания и ответы варианты БИ10201-БИ10204
  • 19.09 Диагностическая работа по русскому языку 5 класс задания и ответы за 1 четверть
  • 19.09 Контрольная работа по русскому языку 11 класс для 56 региона задания и ответы 1 четверть
  • 19.09.2017 школьный этап всероссийской олимпиады по ОБЖ 5-11 класс задания и ответы
  • 19.10.17 Русский язык 11 класс (ЕГЭ) задания и ответы статград варианты РЯ10601-РЯ10602
  • 19.12.2017 КДР геометрия 8 класс краевая диагностическая работа задания и ответы
  • 19.12.2017 КДР математика 9 класс краевая диагностическая работа задания и ответы
  • 19.12.2017 Математика 10 класс тригонометрия база и профиль ответы и задания СтатГрад
  • 2 апреля 11 класс история ВПР
  • 2 апреля 7 класс английский язык ВПР
  • 20. 09 Входная контрольная работа русский язык 7 класс для 56 региона задания и ответы
  • 20.09.2017 История 9 класс варианты ИС90101-ИС90102 ОГЭ задания и ответы
  • 20.11.2017 Русский язык 9 класс «СтатГрад» ОГЭ задания и ответы РЯ90701-РЯ90702
  • 20.12.2017 Химия 9 класс ответы и задания работа Статград варианты ХИ90201-ХИ90202
  • 21.09.17 Математика 11 класс варианты МА10101-МА10108 задания и ответы
  • 21.10.17 ОБЖ 7-11 класс муниципальный этап ВОШ для Москвы ответы и задания
  • 21.11.17 Биология 9 класс СтатГрад задания и ответы варианты БИ90201-БИ90204
  • 21.12.2017 Математика 9 класс РПР для 64 региона задания и ответы 2 этап
  • 21.12.2017 Ответы и задания по математике 11 класс «СтатГрад» база и профиль
  • 21.12.2017 Ответы и задания по русскому языку 10-11 класс варианты КДР 23 регион
  • 22.09.17 Обществознание 9 класс работа статград ОГЭ варианты ОБ90101-ОБ90102 задания и ответы
  • 22.09.17 Русский язык 10 класс входная контрольная работа ФГОС задания и ответы
  • 22. 10 Задания и ответы олимпиады по литературе 7-11 класс муниципальный этап 2017
  • 23 апреля математика 5 класс ВПР 2019
  • 23 апреля русский язык 6 класс ВПР 2019
  • 23 апреля ФИЗИКА 7 класс ВПР 2019
  • 23.11.2017 Задания и ответы по информатике 9 класс для вариантов статград ИН90201-ИН90204
  • 24.10.17 Изложение 9 класс русский язык СтатГрад варианты РЯ90601-РЯ90602
  • 24.10.17 КДР 8 класс математика алгебра задания и ответы 23 регион
  • 24.10.17 Контрольная работа английский язык 7-9 класс для 56 региона письмо
  • 25.09.17 Информатика 9 класс задания и ответы СтатГрад варианты ИН90101-ИН90102
  • 25.10.17 Английский язык 7-9 класс контрольная работа для 56 региона чтение варианты
  • 25.10.17 История 11 класс МЦКО варианты задания и ответы
  • 25.10.17 Русский язык 9 класс МЦКО задания и ответы
  • 26.09 Английский язык 7,8,9 класс контрольная работа для 56 региона задания и ответы ФГОС
  • 26.09.17 История 11 класс задания и ответы «СтатГрад» варианты ИС10101-ИС10102
  • 26.09.17 Математика 11 класс мониторинговая работа ЕГЭ 3 варианта задания и ответы
  • 26.10 ВПР Русский язык 5 класс ответы и задания все реальные варианты
  • 26.10.17 Химия 11 класс «СтатГрад» задания и ответы варианты ХИ10101-ХИ10104
  • 27.09.2017 Математика 9 класс работа статград варианты МА90101-МА90104 задания и ответы
  • 27.10 Задания и ответы для олимпиады по биологии муниципальный этап 2017
  • 28.09.17 Русский язык 11 класс задания и ответы «СтатГрад» варианты РЯ10101-РЯ10102
  • 29.09.17 Математика 10 класс задания и ответы «СтатГрад» варианты МА00101-МА00104
  • 30.11.2017 МЦКО математика 11 класс ответы и задания
  • 4 апреля 11 класс биология ВПР
  • 4 апреля 7 класс обществознание ВПР
  • 4 класс диктант 2019 год
  • 4 класс диктант платно
  • 4 класс математика 22.04.2019-26.04.2019
  • 4 класс математика платно ответы и задания
  • 4 класс окр. мир платно
  • 4 класс окружающий мир 22.04.2019-26.04.2019
  • 4 класс русский тест 2019 год
  • 4 класса тест платно
  • 5 класс биология платно
  • 5 класс история платно
  • 5 класс русский язык впр 25 апреля
  • 5 класс русский язык платно
  • 6 класс история платно
  • 6 класс математика впр 25 апреля
  • 6 класс математика платно
  • 6 класс общество платно
  • 6 класс платно гео ответы и задания
  • 6 класс платно ответы и задания
  • 7 класс ВПР 2019 по географии ответы и задания 16 апреля 2019
  • 7 класс история впр 25 апреля
  • 7 класс русский язык 56 регион ответы и задания 21.12.2018
  • 7.11.17 Английский язык 9 класс от СтатГрад задания и ответы варианты АЯ90101-АЯ90102
  • 8.11.2017 Русский язык 11 класс СтатГрад задания и ответы варианты РЯ10201-РЯ10202
  • 9 апреля география 6 класс ВПР 2019
  • 9 апреля русский язык 7 класс ВПР 2019
  • 9 апреля физика 11 класс ВПР 2019
  • 9 класс английский язык ОГЭ 24 25 мая
  • 9 класс БИОЛОГИЯ ЭКЗАМЕН огэ 2019 год
  • 9 класс информатика огэ 2019 год
  • 9 класс математика огэ 2019 год
  • 9 класс обществознание ОГЭ 2019
  • 9 класс ОГЭ 2019
  • 9 класс русский язык ОГЭ 2019
  • 9 класс ФИЗИКА огэ 2019 год
  • 9 класс ФИЗИКА ЭКЗАМЕН огэ 2019 год
  • 9 класс экзамен по истории огэ 2019 год
  • 9.11.17 Математика 9 класс работа «СтатГрад» задания и ответы варианты МА90201-МА90204
  • British Bulldog 2019 ответы и задания 3-4 класс 10-11 декабря 2019
  • British Bulldog 3-4 класс ответы и задания 2018-2019
  • British Bulldog 5-6 класс ответы и задания 2018-2019
  • British Bulldog 9-11 класс ответы и задания 2018-2019
  • FAQ
  • My Calendar
  • Алгебра 7 класс статград 4 декабря 2019 ответы и задания МА1970101-106
  • Алгебра и начала анализа статград 10 класс 4 декабря 2019 ответы и задания
  • Английский 9 класс СтатГрад задания и ответы
  • Английский язык 11 класс АЯ10301 ответы и задания 23 апреля 2019 год
  • Английский язык 11 класс СтатГрад 17.04
  • Английский язык 11 класс статград 5 декабря 2019 ответы и задания АЯ1910101
  • Английский язык 7 класс ВПР 2020 тренировочные варианты задания и ответы
  • Английский язык 7 класс ВПР ответы и задания 2 апреля 2019 год
  • Английский язык 7-9 класс ответы и задания 56 регион
  • Английский язык 7,8,9 класс мониторинговая работа чтение 2019
  • Английский язык 9 класс ответы и задания АЯ1990101 АЯ1990102 статград 6 ноября 2019
  • Английский язык 9 класс платно
  • Английский язык 9 класс статград ответы и задания 2018-2019 06.11
  • Английский язык аудирование ответы 7 8 9 класс 56 регион 2018-2019
  • Английский язык говорение 56 регион ответы 7 8 9 класс 2018-2019
  • Английский язык задания и ответы школьного этапа олимпиады ВОШ 2019-2020
  • Английский язык ответы 7 8 класс 56 регион чтение 2018-2019
  • Английский язык письмо 7 8 класс ответы и задания 2018-2019
  • Аргументы для тем итогового сочинения 2019-2020 регион МСК+8
  • Архив работ
  • Астра 2019 ответы и задания 3-4 класс 20 ноября 2019
  • Банк заданий ФИПИ по русскому языку ЕГЭ 2019 морфемика и словообразование
  • Биология 10 класс РДР задания и ответы 14 ноября 2019-2020
  • Биология 11 класс 5 ноября 2019 статград ответы и задания БИ1910201-204
  • Биология 11 класс ВПР 2019 ответы и задания 4 апреля 2019 год
  • Биология 11 класс ВПР ответы и задания 11.05
  • Биология 11 класс ответы и задания тренировочная №5 26 апреля 2019
  • Биология 5 класс ВПР 2018 ответы и задания
  • Биология 5 класс ВПР 2019 ответы и задания 18 апреля 2019 год
  • Биология 5 класс ВПР 2020 вариант демоверсии ответы и задания
  • Биология 6 класс ВПР 2018 ответы и задания
  • Биология 6 класс ВПР 2019 ответы и задания 16 апреля 2019
  • Биология 6 класс платно
  • Биология 7 класс ВПР 2019 ответы и задания 11 апреля 2019
  • Биология 7 класс впр статград ответы и задания 11 сентября 2019
  • Биология 9 класс 15 ноября ответы и задания статград 2018
  • Биология 9 класс БИ90501 БИ90502 ответы и задания 23 апреля 2019
  • Биология 9 класс ответы БИ90401 и БИ90402 статград 01.2019
  • Биология 9 класс ответы и задания 25 ноября работа статград БИ1990201-БИ1990204
  • Биология 9-10 класс ответы КДР 24 января 2019
  • Биология ОГЭ 2018 платно
  • Благодарим за ваш заказ!
  • Британский бульдог 7-8 класс ответы и задания 2018-2019
  • Вариант 322 КИМы с реального ЕГЭ 2018 по математике
  • Вариант № 33006761 тренировочный ЕГЭ по математике профильный уровень с ответами
  • Вариант № 33006762 тренировочный ЕГЭ по математике профильный уровень с ответами
  • Вариант №1 морфемика и словообразование банк заданий ФИПИ ЕГЭ 2018-2019
  • Вариант №2 морфемика и словообразование банк заданий ФИПИ ЕГЭ 2018-2019
  • Вариант №3 морфемика и словообразование банк заданий ФИПИ ЕГЭ 2018-2019
  • Вариант №4 морфемика и словообразование банк заданий с ответами ФИПИ ЕГЭ
  • Вариант №5 банк заданий с ответами ФИПИ ЕГЭ 2019 по русскому языку морфемика
  • Вариант №6 банк заданий с ответами ФИПИ ЕГЭ 2019 по русскому языку морфемика
  • Вариант №7 банк заданий с ответами ФИПИ ЕГЭ 2019 по русскому языку морфемика
  • Вариант по биологии с реального ЕГЭ 2020 задания и ответы
  • Варианты БИ1910301-БИ1910304 по биологии 11 класс ответы и задания 14 января 2020
  • Варианты ВПР по физике 11 класс задания и ответы за 2018 год
  • Варианты для проведения ВПР 2020 по математике 6 класс с ответами
  • Ваши отзывы — пожелания
  • Вероятность и статистика 7 класс ответы 16.05
  • Вероятность и статистика 8 класс ответы 16.05
  • Витрина
  • ВКР английский язык 7,8,9 класс задания и ответы говорение 2019-2020
  • ВКР по геометрии 8 класс ответы и задания
  • Возможные варианты для устного собеседования 9 класс ОГЭ 13 марта 2019
  • Вот что с восторгом воскликнул Иван Васильевич готовые сочинения
  • ВОШ всероссийская олимпиада школьников задания и ответы
  • ВОШ ВСЕРОССИЙСКИЕ школьные олимпиады 2017-2018 задания и ответы
  • ВОШ муниципальный этап по обществознанию ответы и задания 2018-2019
  • ВОШ по ОБЩЕСТВОЗНАНИЮ 2017-2018
  • ВОШ Школьный этап 2017-2018 задания и ответы для Республики Коми
  • ВОШ школьный этап по экономике ответы и задания 2018-2019
  • ВПР 11 класс английский язык ответы и задания 20 марта 2018
  • ВПР 11 класс география
  • ВПР 11 класс история ответы и задания 21 марта 2018
  • ВПР 2019 6 класс обществознание ответы и задания 18 апреля 2019 год
  • ВПР 2019 по математике 7 класс ответы и задания 18 апреля 2019 год
  • ВПР 2019 по химии 11 класс ответы и задания 18 апреля 2019 год
  • ВПР 2019 физика 11 класс ответы и задания 9 апреля 2019 год
  • ВПР 2020 6 класс задание №10 по математике с ответами которые будут
  • ВПР 2020 6 класс задание №11 по математике с ответами которые будут
  • ВПР 2020 6 класс задание №6 по математике с ответами
  • ВПР 2020 6 класс задание №7 по математике с ответами
  • ВПР 2020 6 класс задание №8 по математике с ответами
  • ВПР 2020 6 класс задание №9 по математике с ответами которые будут
  • ВПР 2020 английский язык варианты АЯ1910201-АЯ1910202 задания и ответы
  • ВПР 2020 биология 11 класс варианты БИ1910601-БИ1910602 ответы и задания
  • ВПР 2020 биология 5 класс новые варианты с ответами
  • ВПР 2020 вариант демоверсии по биологии 7 класс задания и ответы
  • ВПР 2020 география 10-11 класс варианты ГГ1910401-ГГ1910402 ответы и задания
  • ВПР 2020 география 6 класс варианты ГГ1960101, ГГ1960102 задания и ответы
  • ВПР 2020 год 6 класс задание №12 по математике с ответами которые будут
  • ВПР 2020 год 6 класс задание №12 по русскому языку с ответами
  • ВПР 2020 год 6 класс задание №13 по математике с ответами которые будут
  • ВПР 2020 год 6 класс задание №13 по русскому языку с ответами
  • ВПР 2020 год 6 класс задание №14 по русскому языку с реальными ответами
  • ВПР 2020 демоверсия по биологии 8 класс задания и ответы
  • ВПР 2020 демоверсия по географии 7 класс задания и ответы
  • ВПР 2020 демоверсия по географии 8 класс задания и ответы
  • ВПР 2020 демоверсия по иностранным языкам 7 класс задания и ответы
  • ВПР 2020 демоверсия по истории 7 класс задания и ответы
  • ВПР 2020 демоверсия по истории 8 класс задания и ответы
  • ВПР 2020 демоверсия по математике 7 класс задания и ответы
  • ВПР 2020 демоверсия по математике 8 класс задания и ответы
  • ВПР 2020 демоверсия по обществознанию 7 класс задания и ответы
  • ВПР 2020 демоверсия по обществознанию 8 класс задания и ответы
  • ВПР 2020 демоверсия по русскому языку 7 класс задания и ответы
  • ВПР 2020 демоверсия по русскому языку 8 класс задания и ответы
  • ВПР 2020 задание 6 по русскому языку 6 класс с ответами
  • ВПР 2020 задание №1 по математике 6 класс с ответами
  • ВПР 2020 задание №1 по русскому языку 6 класс с ответами
  • ВПР 2020 задание №10 по русскому языку 6 класс ответы которые будут
  • ВПР 2020 задание №11 по русскому языку 6 класс ответы которые будут
  • ВПР 2020 задание №2 по математике 6 класс с ответами
  • ВПР 2020 задание №2 по русскому языку 6 класс с ответами
  • ВПР 2020 задание №3 по математике 6 класс с ответами
  • ВПР 2020 задание №3 по русскому языку 6 класс с ответами
  • ВПР 2020 задание №4 по математике 6 класс с ответами
  • ВПР 2020 задание №4 по русскому языку 6 класс с ответами
  • ВПР 2020 задание №5 по математике 6 класс с ответами
  • ВПР 2020 задание №5 по русскому языку 6 класс с ответами
  • ВПР 2020 задание №7 по русскому языку 6 класс с реальными ответами
  • ВПР 2020 задание №8 по русскому языку 6 класс с реальными ответами
  • ВПР 2020 задание №9 по русскому языку 6 класс ответы которые будут
  • ВПР 2020 математика 5 класс реальные задания с ответами
  • ВПР 2020 новые варианты с ответами по русскому языку 7 класс
  • ВПР 2020 ответы и задания всероссийские проверочные работы
  • ВПР 2020 по биологии 6 класс задание №1 с ответами
  • ВПР 2020 по биологии 6 класс задание №10 с реальными ответами
  • ВПР 2020 по биологии 6 класс задание №2 с ответами
  • ВПР 2020 по биологии 6 класс задание №3 с ответами
  • ВПР 2020 по биологии 6 класс задание №4 с ответами
  • ВПР 2020 по биологии 6 класс задание №6 с ответами
  • ВПР 2020 по биологии 6 класс задание №7 с ответами
  • ВПР 2020 по биологии 6 класс задание №8 с реальными ответами
  • ВПР 2020 по биологии 6 класс задание №9 с реальными ответами
  • ВПР 2020 по биологии 7 класс тренировочные варианты БИ1970201,БИ1970202
  • ВПР 2020 по истории 6 класс задание 1 с ответами
  • ВПР 2020 по истории 6 класс задание №10 с реальными ответами
  • ВПР 2020 по истории 6 класс задание №2 с ответами
  • ВПР 2020 по истории 6 класс задание №3 с ответами
  • ВПР 2020 по истории 6 класс задание №4 с реальными ответами
  • ВПР 2020 по истории 6 класс задание №5 с реальными ответами
  • ВПР 2020 по истории 6 класс задание №6 с реальными ответами
  • ВПР 2020 по истории 6 класс задание №7 с реальными ответами
  • ВПР 2020 по истории 6 класс задание №8 с реальными ответами
  • ВПР 2020 по истории 6 класс задание №9 с реальными ответами
  • ВПР 2020 по математике 7 класс задание 11 реальное с ответами
  • ВПР 2020 по математике 7 класс задание 12 реальное с ответами
  • ВПР 2020 по математике 7 класс задание №1 реальное с ответами
  • ВПР 2020 по математике 7 класс задание №13 реальное с ответами
  • ВПР 2020 по математике 7 класс задание №2 реальное с ответами
  • ВПР 2020 по математике 7 класс задание №8 реальное с ответами
  • ВПР 2020 русский язык 8 класс варианты РУ1980201, РУ1980202 ответы
  • ВПР 2020 тренировочные варианты по географии 8 класс задания с ответами
  • ВПР 2020 тренировочные варианты по русскому языку 5 класс задания с ответами
  • ВПР 2020 физика 11 класс варианты ФИ1910601-ФИ1910602 ответы и задания
  • ВПР 2020 химия 8 класс демоверсия задания и ответы
  • ВПР 2021 ответы и задания всероссийские проверочные работы
  • ВПР 4 класс математика 2020 год реальные официальные задания и ответы
  • ВПР БИОЛОГИЯ 11 класс 2018 реальные ответы и задания
  • ВПР география 10-11 класс
  • ВПР математика 5 класс ответы и задания
  • ВПР по истории 11 класс ответы и задания 18.05
  • ВПР ФИЗИКА 11 класс 2018
  • ВПР физика 11 класс резервный день ответы
  • ВПР ХИМИЯ 11 05.04
  • ВСЕРОССИЙСКАЯ олимпиада муниципальный этап 2018-2019 задания и ответы
  • ВСЕРОССИЙСКАЯ олимпиада муниципальный этап 2019-2020 задания и ответы
  • Всероссийская олимпиада по праву ответы и задания школьный этап 25-26 октября 2019
  • Всероссийская олимпиада по химии ответы и задания школьный этап 21-22 октября 2019
  • ВСЕРОССИЙСКАЯ олимпиада региональный этап 2018-2019 задания и ответы
  • Всероссийская олимпиада школьников региональный этап 2019-2020 задания и ответы
  • ВСЕРОССИЙСКАЯ олимпиада школьный этап 2019-2020 задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2017-2018 муниципальный этап задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2017-2018 муниципальный этап задания и ответы для Краснодарского края
  • ВСЕРОССИЙСКИЕ олимпиады 2017-2018 муниципальный этап задания и ответы для Челябинской области
  • ВСЕРОССИЙСКИЕ олимпиады 2017-2018 региональный этап задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2017-2018 учебный год задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2017-2021 задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2018-2019 учебный год задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2018-2019 школьный этап задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2019-2020 учебный год задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2020-2021 муниципальный этап задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2020-2021 региональный этап задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2020-2021 школьный этап задания и ответы
  • ВСЕРОССИЙСКИЕ олимпиады 2021 заключительный этап задания и ответы
  • Всероссийские проверочные работы 2017 задания и ответы
  • Всероссийские проверочные работы 2017-2018 задания и ответы
  • Всероссийские проверочные работы 2018-2019 задания и ответы
  • Всесибирская олимпиада школьников задания и ответы по математике 2018-2019
  • Входная контрольная работа по математике 11 класс ответы и задания 2019-2020
  • Входная контрольная работа по математике 4 класс ответы и задания 2019-2020
  • Входная контрольная работа по математике 5 класс ответы и задания 2019-2020
  • Входная работа по русскому языку 11 класс ответы и задания ФГОС 2019-2020
  • Гарантия
  • ГГ1910101 ответы и задания география 11 класс статград 4 октября 2019
  • ГДЗ 5 классы решебники
  • ГДЗ по Математике за 5 класс: Виленкин Н.Я
  • ГДЗ решебники
  • Гелиантус АСТРА 1-2 класс ответы и задания 2018-2019
  • Гелиантус АСТРА 3-4 класс ответы и задания 2018-2019
  • География 10-11 класс ВПР 2019 ответы и задания 11 апреля 2019
  • География 11 класс ответы и задания 17 апреля 2019 тренировочная №4
  • География 11 класс ответы и задания вариант ГГ10101 статград 2018-2019
  • География 11 класс платно
  • География 11 класс статград ЕГЭ ответы и задания
  • География 6 класс ВПР 2019 ответы и задания 9 апреля 2019
  • География 6 класс ВПР 2020 год задание 7 и официальные ответы
  • География 6 класс ВПР 2020 год задание №8 и реальные ответы
  • География 6 класс ВПР 2020 задание №2 официальное с ответами
  • География 6 класс ВПР 2020 задание №3 с ответами официальные
  • География 6 класс ВПР 2020 задание №4 с ответами официальные
  • География 6 класс ВПР 2020 задание №5 с ответами официальные
  • География 6 класс ВПР 2020 задание №6 и официальные ответы
  • География 6 класс задание №1 реального ВПР 2020 с ответами
  • География 9 класс ОГЭ 4 июня 2019 год
  • География 9 класс ответы и задания ГГ90401 ГГ90402 22 апреля 2019
  • География 9 класс ответы и задания тренировочная статград 18 марта 2019
  • География 9 класс СтатГрад задания и ответы
  • География 9 класс статград ответы и задания 13 марта 2018
  • География задания и ответы школьный этап 2019-2020 всероссийской олимпиады
  • География муниципальный этап 2019 задания и ответы всероссийской олимпиады
  • Геометрия 9 класс ответы и задания 12 декабря 2019 работа статград
  • Готовое итоговое сочинение 2018-2019 на тему может ли добрый человек проявлять жестокость?
  • Готовые сочинения для варианта №1 из сборника ЕГЭ 2021 Цыбулько И.П
  • Готовые сочинения для варианта №2 из сборника ЕГЭ 2021 Цыбулько И.П
  • Готовые сочинения для варианта №3 из сборника ЕГЭ 2021 Цыбулько И.П
  • Готовые сочинения для варианта №4 из сборника ЕГЭ 2021 Цыбулько И.П
  • Готовые сочинения для варианта №5 из сборника ЕГЭ 2021 Цыбулько И.П
  • Готовые сочинения для варианта №6 из сборника ЕГЭ 2021 Цыбулько И.П
  • Готовые сочинения для варианта №7 из сборника ЕГЭ 2021 Цыбулько И.П
  • Готовые сочинения ЕГЭ в избушке у самого леса живёт старый охотник
  • Готовые сочинения ЕГЭ несомненно Дюма останется ещё на многие
  • Готовые сочинения ЕГЭ ты часто жаловался мне, что тебя «не понимают!»
  • Готовые сочинения как-то Анатолий Бочаров высказал по тексту В. В. Быкову
  • Готовые сочинения на Невском, у Литейного постоянно толпились
  • Готовые сочинения по тексту Ф. М. Достоевскому в эту ночь снились мне
  • Готовые сочинения чего нам так не хватает а не хватает нам любви к детям по тексту А. А. Лиханову
  • Готовые сочинения я очень плохо знаю деревенскую жизнь с проблемами и текстом
  • ДВИ МГУ варианты ответы и программы вступительных испытаний
  • Демоверсия ВПР 2020 география 6 класс задания и ответы фипи
  • Демоверсия ВПР 2020 история 6 класс задания и ответы фипи
  • Демоверсия ВПР 2020 по биологии 6 класс задания и ответы фипи
  • Демоверсия ВПР 2020 по обществознанию 6 класс задания и ответы фипи
  • Демоверсия ОГЭ 2019 по математике решение заданий
  • Диктант по русскому языку 4 класс ВПР 2018 задания
  • ДКР 2019 по географии 10 класс ответы и задания Свердловская область
  • ДКР 2019 по географии 7 класс задания и ответы 11 декабря 2019-2020
  • Добро пожаловать
  • Доступ ко всем работам
  • ЕГЭ 2020 тренировочный вариант 200622 с ответами по истории 11 класс
  • Если хочешь понять душу леса найди лесной 9 готовых сочинений ЕГЭ
  • Естественные науки ответы и задания олимпиада ЗВЕЗДА 25-29 ноября 2019-2020
  • за эти месяцы тяжелой борьбы решающей 9 готовых сочинений ЕГЭ
  • Задание № 15 неравенства ОГЭ по математике 9 класс 2020
  • Задания ВПР 2017 для 11 класса по географии
  • Задания ВПР 2017 для 4 класса по русскому языку
  • Задания ВПР 2017 для 5 класса по математике
  • Задания заключительного этапа ВСЕРОССИЙСКОЙ олимпиады по информатике 2017/2018
  • Задания и ответы 2 варианта пробного экзамена ЕГЭ по математике 11 класс 4 апреля 2018
  • Задания и ответы 56 регион на ФЕВРАЛЬ 2017
  • Задания и ответы 6 класс XXX математический праздник 2019 год
  • Задания и ответы Англ.яз 18.11
  • Задания и ответы Биология 14.11
  • Задания и ответы Биология 9 класс 21.11.
  • Задания и ответы всероссийской олимпиады по русскому языку Московской области 19 ноября 2017
  • Задания и ответы ГЕОГРАФИЯ 21.11.2017
  • Задания и ответы для комплексной работы КДР для 8 класса ФГОС 4 варианта
  • Задания и ответы для Оренбургской области 56 регион декабрь 2017
  • Задания и ответы для Оренбургской области ноябрь 2017
  • Задания и ответы для Оренбургской области октябрь 2017
  • Задания и ответы для Оренбургской области сентябрь 2017
  • Задания и ответы для работ 11 регион Республика Коми 2018-2019
  • Задания и ответы для работ 11 региона Республика Коми Декабрь 2018-2019
  • Задания и ответы для работ 11 региона Республика Коми НОЯБРЬ 2018-2019
  • Задания и ответы для работ 56 региона октябрь 2018
  • Задания и ответы для работ Республики Коми
  • Задания и ответы для регионального этапа по физической культуре 2018
  • Задания и ответы для школьных работ Оренбургской области 56 регион декабрь 2018
  • Задания и ответы для школьных работ Оренбургской области 56 регион февраль 2018
  • Задания и ответы КДР 2019 математика 9 класс 20 февраля
  • Задания и ответы Математика 03.12
  • Задания и ответы Математика 17.11
  • Задания и ответы муниципального этапа 2019-2020 по немецкому языку 7-11 класс ВСОШ
  • Задания и ответы муниципального этапа по русскому языку 2019-2020 Москва
  • Задания и ответы МХК 15.11
  • Задания и ответы на Апрель 2017 для 56 региона
  • Задания и ответы на Май 2017 для 56 региона
  • Задания и ответы на Март 2017 для 56 региона
  • Задания и ответы олимпиады по литературе региональный этап 2020
  • Задания и ответы по информатике 11 класс 28 ноября 2017 СтатГрад варианты ИН10201-ИН10204
  • Задания и ответы по истории для 11 классов (56 регион)
  • Задания и ответы по математике 11 класс профиль вариант №22397963
  • Задания и ответы по математике 11 класс профиль ЕГЭ вариант №22397967
  • Задания и ответы по математике 6 класс ВПР 2018
  • Задания и ответы по русскому языку 6 класс ВПР 2018
  • Задания и ответы по русскому языку 9 класс СтатГрад 29 ноября 2017 варианты РЯ90201-РЯ90202
  • Задания и ответы по физике муниципального этапа 2019 всероссийская олимпиада
  • Задания и ответы по химии 11 класс СтатГрад 30 ноября 2017 года варианты ХИ10201-ХИ10204
  • Задания и ответы ПРАВО 14.11
  • Задания и ответы право региональный этап ВОШ 2019
  • Задания и ответы регионального этапа 2019 по английскому языку
  • Задания и ответы регионального этапа 2019 по испанскому языку
  • Задания и ответы регионального этапа 2019 по китайскому языку
  • Задания и ответы регионального этапа 2019 по химии ВОШ
  • Задания и ответы региональный этап ВОШ 2019 по французскому
  • Задания и ответы Русский язык 19.11
  • Задания и ответы Русский язык ОГЭ 9 класс 20.11.
  • Задания и ответы Физика 18.11
  • Задания и ответы Химия 24.11
  • Задания Московской математической олимпиады 8 класс 17 марта 2019 год
  • Задания МОШ 2019 по физике 1 тур 7 8 9 10 класс
  • Задания по истории муниципальный этап 11 ноября всероссийской олимпиады 2018-2019
  • Задания, ответы и результаты олимпиады по биологии региональный этап 2020
  • Задания, ответы и результаты олимпиады по химии региональный этап 2020
  • Заключительный этап всероссийской олимпиады школьников 2019-2020 задания и ответы
  • Закрытый раздел
  • Золотое руно 2018 ответы и задания 16 февраля конкурс по истории
  • Изложение русский язык 9 класс статград ответы и задания 4 октября 2019
  • Информатика 11 класс 15 ноября 2019 статград ответы и задания ИН1910201- ИН1910204
  • Информатика 11 класс КДР ответы и задания 18 декабря 2018
  • Информатика 11 класс платно
  • Информатика 11 класс СтатГрад задания и ответы
  • Информатика 11 класс тренировочная №5 ответы и задания 15 апреля 2019 год
  • Информатика 7 класс ответы РДР 21 февраля 2019
  • Информатика 9 класс 06.03
  • Информатика 9 класс ОГЭ 4 июня 2019 год
  • Информатика 9 класс ответы и задания тренировочная №5 25 апреля 2019
  • Информатика 9 класс ответы статград 13 ноября 2018
  • Информатика 9 класс ответы статград 31 января 2019
  • Информатика ВОШ школьный этап ответы и задания 2018-2019
  • Информатика ОГЭ 2018
  • Информатика ОГЭ 2018 платно
  • Информатика ответы и задания школьный этап 2019 всероссийской олимпиады школьников
  • История 10 класс РДР 2019 официальные задания и ответы все варианты
  • История 11 класс 13 ноября 2019 ответы и задания статград вариант ИС1910201- ИС1910204
  • История 11 класс ВПР 2018 год задания и ответы все варианты
  • История 11 класс ВПР 2019 ответы и задания 2 апреля 2019 год
  • История 11 класс ВПР 2020 тренировочные варианты с ответами
  • История 11 класс задания и ответы СтатГрад
  • История 11 класс ИС10201 и ИС10202 ответы и задания статград 23.11.2018
  • История 11 класс ответы и задания СтатГрад 24.04
  • История 11 класс ответы ИС10401 и ИС10402 11 марта 2019 год
  • История 11 класс СтатГрад 24 ноября 2017 задания и ответы варианты ИС10201-ИС10204
  • История 5 класс ВПР 2018 ответы и задания
  • История 5 класс ВПР 2019 ответы и задания 16 апреля 2019
  • История 5 класс ВПР 2020 вариант демоверсии ответы и задания
  • История 5 класс ВПР 25.04
  • История 6 класс ВПР 2018 ответы и задания
  • История 6 класс ВПР 2019 ответы и задания 11 апреля 2019
  • История 6 класс тренировочные варианты ВПР 2020 задания и ответы
  • История 7 класс ВПР 2019 ответы и задания варианты 25 апреля
  • История 7 класс платно 24 апреля
  • История 9 класс входная контрольная работа ФГОС задания и ответы 2019-2020
  • История 9 класс ответы и задания тренировочная №5 26 апреля 2019 год
  • История 9 класс СтатГрад 27 февраля ответы и задания
  • История 9 класс статград ответы и задания 2018-2019
  • История 9 класс статград ответы и задания 30 марта 2018
  • История всероссийская олимпиада школьный этап 2019-2020 задания и ответы московская область
  • Итоговая контрольная работа по математике 8 класс за 2018-2019 учебный год
  • Итоговая контрольная работа по русскому языку 7 класс за 2018-2019 учебный год
  • Итоговая работа математика 10 класс ответы и задания 24 апреля 2019 год
  • Итоговое собеседование варианты 12 февраля 2020
  • Итоговое сочинение 05.12.2018
  • Итоговое сочинение 2017
  • Как написать эссе по обществознанию ЕГЭ
  • Как получить задания и ответы для ВПР 2019
  • Как получить работу задания и ответы
  • Как получить темы на итоговое сочинение 6 декабря 2017 года
  • Как человеку воспитать в себе доброту? готовое итоговое сочинение 2018-2019
  • КДР (задания+ответы) на Февраль 2017
  • КДР (задания+ответы) на Январь 2017
  • КДР 1 класс задания и ответы комплексная работа варианты 2018 год
  • КДР 2 класс задания и ответы комплексная работа варианты 2018 год
  • КДР 2019 23 регион ответы и задания май 2019 год
  • КДР 2019 задания и ответы по английскому языку 8 класс 21 мая 2019 год
  • КДР 2019 ответы и задания апрель 2019 год
  • КДР 2019 ответы по географии 9 класс 15 февраля
  • КДР 2019 химия 9 и 10 класс ответы 19 марта 2019 год
  • КДР 2019-2020 декабрь 23 регион ответы и задания
  • КДР 2020 23 регион ответы и задания Краснодарский край
  • КДР 9 класс русский язык ответы и задания 14 декабря 2018
  • КДР Английский язык 8 класс ответы и задания 2018-2019
  • КДР апрель 2017 работы задания и ответы
  • КДР апрель 2018 задания и ответы для Краснодарского края 23 регион
  • КДР декабрь 2017 задания и ответы для Краснодарского края 23 регион
  • КДР задания и ответы
  • КДР задания и ответы комплексная работа 3 класс 2018 год
  • КДР задания и ответы комплексная работа 4 класс варианты 2018 год
  • КДР Май 2017 работы задания и ответы
  • КДР Май 2018 задания и ответы для Краснодарского края 23 регион
  • КДР математика 11 класс задания и ответы 28 февраля 2018 год
  • КДР математика 7 класс ответы и задания 12.04
  • КДР математика 9 класс 19.04
  • КДР ответы и задания 23 регион Январь 2019
  • КДР ответы и задания для Краснодарского края 23 регион ДЕКАБРЬ 2018
  • КДР ответы и задания математика 10-11 класс 23 ноября 2018
  • КДР ответы и задания НОЯБРЬ 2018 для Краснодарского края 23 регион
  • КДР ответы и задания октябрь 2018 для Краснодарского края 23 регион
  • КДР ответы и задания по английскому языку 9 10 11 класс 8 февраля 2018
  • КДР ответы и задания по Биологии 10 класс 23 января 2018
  • КДР ответы и задания по Биологии 11 класс 23 января 2018
  • КДР ответы и задания по Биологии 9 класс 23 января 2018
  • КДР ответы и задания по Географии 10 класс 25 января 2018
  • КДР ответы и задания по Географии 9 класс 25 января 2018
  • КДР ответы и задания по информатике 10 класс 18 января 2018
  • КДР ответы и задания по информатике 9 класс 18 января 2018
  • КДР ответы и задания по истории 9 10 11 класс 13 февраля 2018
  • КДР ответы и задания по обществознанию 9 10 11 класс 1 февраля 2018
  • КДР ответы и задания по русскому языку 9 класс 6 февраля 2018
  • КДР ответы и задания по химии 10 11 класс 6 февраля 2018
  • КДР ответы математика 7 класс 30 января 2019
  • КДР ответы русский язык 9 класс 6 февраля 2019
  • КДР ответы физика 9-10 класс 31 января 2019
  • КДР по алгебре 8 класс ответы и задания 2018-2019
  • КДР ПО ГЕОГРАФИИ 11 КЛАСС 23 регион ответы и задания 22 февраля
  • КДР по литературе 10 11 класс 2018 ответы и задания
  • КДР по литературе 10 класс ответы
  • КДР по Математике 9 класс официальные ответы
  • КДР по русскому языку для 9 классов
  • КДР русский язык 7 8 класс ответы и задания
  • КДР русский язык 7-8 класс ответы 17.05
  • КДР февраль 2018 задания и ответы для Краснодарского края 23 регион
  • КДР январь 2018 задания и ответы для Краснодарского края 23 регион
  • Кенгуру 2017 9 класс ответы
  • Кенгуру 2017 ответы и задания 2-10 класс
  • Кенгуру 2019 ответы и задания 5-6 класс
  • Кенгуру 2019 ответы и задания для 7-8 класса
  • КИТ 2-3 класс ответы и задания 2018-2019
  • КИТ 8-9 класс ответы и задания 2018-2019
  • КИТ-2019 ответы и задания 10-11 класс 27 ноября 2019-2020
  • Комплексная работа ФГОС 5 6 7 8 9 класс ответы и задания 30 ноября 2018
  • Конкурс АСТРА 2019 ответы и задания 5-6 класс 20 ноября 2019
  • Конкурс КИТ 2018 4-5 класс ответы и задания
  • Конкурс КИТ 2019 ответы и задания 2-3 класс 27 ноября 2019
  • Контакты
  • Контрольная входная работа по русскому языку 10 класс ответы и задания 2019-2020
  • Контрольная работа за 1 полугодие по русскому языку 7 класс ответы и задания
  • Контрольная работа по математике 11 класс 2 четверть в формате ЕГЭ 3 варианта с ответами
  • Контрольная работа по русскому языку 10 класс за 1 полугодие 2 варианта с ответами
  • Контрольная работа по русскому языку 8 класс за 1 полугодие 2 четверть задания и ответы
  • Контрольные работы ОГЭ 2021 задания и ответы для 9 класса
  • Контрольные срезы 56 регион ответы и задания октябрь 2019-2020
  • Корзина
  • Критерии ответы и задания по физике 11 класс статград 23 марта 2018
  • Критерии ответы по информатике 11 класс статград 16 марта 2018
  • Критерии ответы по русскому языку 11 класс статград 2018
  • Кружила январская метелица скрипели мерзлые готовые сочинения ЕГЭ
  • Куда поступить после 11 класса в 2017 году
  • Литература 11 класс ответы и задания ЕГЭ статград 22.03.2018
  • Литература 11 класс СтатГрад задания и ответы
  • Литература 9 класс ОГЭ 2019 год
  • Литература 9 класс ответы и задания статград 22 ноября 2018 год
  • Литература 9 класс статград ОГЭ сочинение ответы 14 марта 2018
  • Литература ОГЭ 2018 платно
  • Литература олимпиада ВОШ задания муниципальный этап 2018-2019
  • Литература ответы и задания школьный этап 2019 всероссийской олимпиады школьников
  • Литература ответы и задания школьный этап всероссийской олимпиады школьников 2019-2020
  • Литература школьный этап 2019-2020 задания и ответы олимпиады ВОШ
  • Математика 7 классов 56 регион задания и ответы
  • Математика 10 класс (вероятность и статистика)
  • Математика 10 класс 56 регион ответы 16.05
  • Математика 10 класс вероятность и статистика ответы и задания 4 апреля 2019
  • Математика 10 класс задания и ответы мониторинговая работа ФГОС 2019-2020
  • Математика 10 класс ответы и задания 18.05
  • Математика 10 класс ответы и задания статград
  • Математика 10 класс ответы и задания статград 2018-2019
  • Математика 10 класс статград ответы и задания 29.03.2018
  • Математика 10 класс статград ответы и задания БАЗА и ПРОФИЛЬ
  • Математика 10 класс тригонометрия ответы статград 18.12.2018
  • Математика 10-11 класс ответы и задания варианты статград 17 мая 2019
  • Математика 10-11 класс ответы и задания СтатГрад
  • Математика 11 класс 17 декабря 2019 контрольная работа задания и ответы
  • Математика 11 класс диагностическая работа ЕГЭ профиль задания и ответы для 11 региона
  • Математика 11 класс КДР ответы и задания 28 февраля
  • Математика 11 класс ответы база профиль статград 24 января 2019
  • Математика 11 класс ответы и задания БАЗА ПРОФИЛЬ 20.09
  • Математика 11 класс ответы и задания тренировочная работа №5 19 апреля 2019
  • Математика 11 класс ответы статград БАЗА ПРОФИЛЬ 20.12.2018
  • Математика 11 класс профиль 56 рег
  • Математика 11 класс тренировочная №4 статград ответы и задания 13 марта 2019
  • Математика 3 класс задания ВСОКО МЦКО итоговая работа 2019
  • Математика 4 класс ВПР 2018 ответы и задания
  • Математика 4 класс ВПР ответы 25.04
  • Математика 4 класс демоверсия ВПР 2020 задания и ответы ФИПИ
  • Математика 5 класс ВПР 2018 ответы и задания
  • Математика 5 класс ВПР 2019 ответы и задания 23 апреля
  • Математика 5 класс задания и ответы СтатГрад варианты 12 сентября 2017 год
  • Математика 5 класс контрольная работа за 1 полугодие задания и ответы 2019-2020
  • Математика 5 класс официальная демоверсия ВПР 2020 задания и ответы
  • Математика 5 класс платно
  • Математика 6 класс ВПР 2018 ответы и задания
  • Математика 6 класс ВПР 2019 ответы и задания варианты 25 апреля
  • Математика 6 класс ВПР 2020 демоверсия фипи задания и ответы
  • Математика 6 класс ответы СтатГрад 15.05
  • Математика 7 класс ответы и задания варианты МА70301 МА70302 14 мая 2019
  • Математика 7 класс РДР ответы 2018-2019
  • Математика 8 класс 56 регион 17.03
  • Математика 8 класс 56 регион ответы и задания 15 марта 2018
  • Математика 8 класс входная контрольная работа ответы и задания 2019-2020
  • Математика 8 класс задания и ответы работа статград 12 сентября 2017
  • Математика 8 класс ответы и задания варианты МА80201 МА80202 14 мая 2019
  • Математика 8 класс ответы и задания по диагностической работе 11 регион 2018-2019
  • Математика 8 класс статград ответы и задания
  • Математика 9 класс — 64 регион ответы
  • Математика 9 класс 12 ноября 2019 ответы и задания работа статград МА1990201-04
  • Математика 9 класс 13.02
  • Математика 9 класс 56 рег ответы
  • Математика 9 класс контрольная работа в формате ОГЭ 4 варианта ответы и задания
  • Математика 9 класс ОГЭ 2018 ответы и задания
  • Математика 9 класс ответы 11 регион 18.12.2018
  • Математика 9 класс ответы 15.05 СтатГрад
  • Математика 9 класс ответы и задания 11 регион 4 октября 2018
  • Математика 9 класс ответы и задания варианты 56 регион 10 октября 2019
  • Математика 9 класс ответы и задания РПР 64 регион 20.12.2018
  • Математика 9 класс ответы и задания статград 19 марта 2019
  • Математика 9 класс ответы и задания статград варианты 15 мая 2019 год
  • Математика 9 класс ответы РПР 64 регион 2019 3 этап 20 марта
  • Математика 9 класс пробник статград ответы и задания 21 марта 2018
  • Математика 9 класс статград ОГЭ ответы и задания
  • Математика 9 класс статград ответы и задания 13 февраля 2018 года
  • Математика 9 класс статград ответы и задания 27.09.2018
  • Математика База платно
  • Математика геометрия 9 класс КДР ответы и задания 20 февраля 2018
  • Математика задания и ответы муниципальный этап ВОШ 2018-2019 для Москвы
  • Математика олимпиада ВОШ 2018-2019 школьный этап задания и ответы
  • Математика ответы и задания для школьного этапа всероссийской олимпиады 2019-2020
  • Математика профиль 11 класс 56 регион контрольная работа 18.12.2018
  • Математика тренировочная работа 9 класс ответы статград 8 ноября 2018 года
  • Математическая вертикаль ответы и задания 2020-2021 учебный год
  • Международный молодёжный предметный чемпионат по правоведению для 10-11 классов.
  • Многопрофильная инженерная олимпиада «Звезда» 2017-2018 задания и ответы
  • Многопрофильная инженерная олимпиада «Звезда» 2018-2019 ответы и задания
  • Многопрофильная олимпиада Звезда 2019-2020 ответы и задания
  • Многопрофильная олимпиада Звезда 2020-2021 ответы и задания
  • Мой аккаунт
  • Мониторинговая работа аудирование по английскому языку 7,8,9 класс задания и ответы 2019-2020
  • Мониторинговая работа по английскому языку 7,8,9 класс задания и ответы 2019
  • Мониторинговая работа по русскому языку 5 класс ответы и задания ФГОС 2019-2020
  • Мониторинговая работа по русскому языку 8 класс ответы и задания ФГОС 2019-2020
  • Мониторинговые работы 56 регион ответы и задания сентябрь 2019
  • Московская олимпиада школьников 2020-2021 ответы и задания
  • Московский турнир юных физиков задания 2019-2020 учебный год
  • МПУ МЦКО 4 класс задания 31 января 2019 год
  • Муниципальный этап 2019 олимпиады по испанскому языку задания и ответы ВОШ
  • Муниципальный этап 2019 олимпиады по истории задания и ответы ВСОШ
  • Муниципальный этап 2019-2020 олимпиада по ОБЖ ответы и задания для Москвы
  • Муниципальный этап 2019-2020 олимпиады по химии задания и ответы Московская область
  • Муниципальный этап 2019-2020 олимпиады по экологии ответы и задания ВсОШ Москва
  • Муниципальный этап 2019-2020 по литературе ответы и задания ВсОШ Москва
  • Муниципальный этап ВОШ 2018 по праву задания и ответы для Москвы
  • Муниципальный этап ВОШ 2018-2019 задания по химии в Московской области
  • Муниципальный этап ВОШ по астрономии ответы и задания 2018-2019 учебный год
  • Муниципальный этап ВОШ по ОБЖ ответы и задания 2018-2019
  • Муниципальный этап олимпиады 2019 по искусству МХК задания и ответы ВСОШ
  • Муниципальный этап олимпиады 2019-2020 по астрономии задания и ответы Московская область
  • Муниципальный этап олимпиады по биологии ответы и задания 19 октября 2019
  • Муниципальный этап по астрономии всероссийской олимпиады задания 2018-2019
  • Муниципальный этап по обществознанию 2019-2020 ответы и задания ВСОШ Москва
  • Муниципальный этап по экономике всероссийская олимпиада 2018-2019
  • МХК искусство задания и ответы муниципального этапа 2019-2020 учебный год
  • МХК искусство школьный этап 2019 ответы и задания всероссийской олимпиады школьников
  • МХК муниципальный этап 8 ноября задания всероссийской олимпиады 2018-2019
  • МЦКО 2019-2020 расписание и демоверсии диагностических работ
  • МЦКО 2020-2021 расписание и демоверсии диагностических работ с ответами
  • МЦКО 7 класс математика ответы 13 февраля 2018
  • МЦКО 8 класс метопредмет ответы и задания 27 февраля
  • МЦКО 8 класс ответы 15.03
  • МЦКО история 10 класс ответы 25.10.2018
  • МЦКО математика 3 класс задания
  • Мцко математика 7 класс 02.03.17
  • МЦКО математика 9 класс варианты задания и ответы 2019-2020
  • МЦКО математика 9 класс ответы и задания 3 октября 2018
  • МЦКО ответы и задания по русскому языку 11 класс 18 января 2018
  • МЦКО ответы и задания по русскому языку 7 8 класс 1 февраля 2018
  • МЦКО по физике для 9 классов
  • МЦКО русский язык 9 класс ответы 2018-2019
  • МЦКО физика для 7 классов ответы и задания
  • Направления тем итогового сочинения 2017-2018
  • Наше наследие 1-4 класс школьный тур ответы и задания 2019-2020
  • Наше наследие 5-11 класс муниципальный тур ответы и задания 2019-2020
  • Наше наследие олимпиада задания и ответы 2017-2018
  • Наше наследие ответы и задания 5-6 класс школьный тур 2019-2020
  • Наше наследие ответы и задания 9-11 класс школьный тур 2019-2020
  • Новый тренировочный вариант 200622 по биологии 11 класс ЕГЭ 2020 с ответами
  • Новый тренировочный вариант 200622 по физике 11 класс ЕГЭ 2020 с ответами
  • Новый тренировочный вариант 210201 по английскому языку 11 класс ЕГЭ 2021 с ответами
  • Новый тренировочный вариант 210201 по истории 11 класс ЕГЭ 2021 с ответами
  • Новый тренировочный вариант 210201 по литературе 11 класс ЕГЭ 2021 с ответами
  • Новый тренировочный вариант 210201 по обществознанию 11 класс ЕГЭ 2021 с ответами
  • Новый тренировочный вариант 210208 по химии 11 класс ЕГЭ 2021 с ответами
  • Новый тренировочный вариант 34072997 по математике профиль 11 класс ЕГЭ с ответами
  • Новый тренировочный вариант 34072998 по математике профиль 11 класс ЕГЭ с ответами
  • Новый тренировочный вариант 34072999 по математике профиль 11 класс ЕГЭ 2021 с ответами
  • Новый тренировочный вариант 34073000 по математике профиль 11 класс ЕГЭ 2021 с ответами
  • Новый тренировочный вариант ЕГЭ 34073001 по математике профильный с ответами
  • Новый тренировочный вариант КИМ 210208 по биологии 11 класс ЕГЭ 2021 с ответами
  • Новый тренировочный вариант КИМ 210208 по физике 11 класс ЕГЭ 2021 с ответами
  • О нас
  • ОБ1910201-ОБ1910204 ответы и задания обществознание 11 класс 13 декабря 2019
  • ОБЖ школьный этап задания и ответы олимпиады ВОШ 2019-2020
  • Обществознание 10 класс КДР 2019 задания и ответы 01.03.2019
  • Обществознание 11 класс 04.05
  • Обществознание 11 класс ответы тренировочная №4 статград 20 марта 2019
  • Обществознание 11 класс статград ЕГЭ ответы и задания 19 марта 2018
  • Обществознание 11 класс СтатГрад задания и ответы
  • Обществознание 11 класс Статград ответы и задания
  • Обществознание 6 класс ВПР 2018 ответы и задания
  • Обществознание 7 класс ВПР 2019 ответы и задания 4 апреля 2019 год
  • Обществознание 9 11 класс контрольная работа 56 регион 20 февраля 2018
  • Обществознание 9 класс 19 декабря 2019 ответы и задания ОБ1990201-ОБ1990204
  • Обществознание 9 класс КДР 2019 ответы 01.03.2019
  • Обществознание 9 класс ответы и задания 29 апреля 2019 тренировочная №5
  • Обществознание 9 класс СтатГрад задания и ответы
  • Обществознание 9 класс тренировочная №4 статград ответы и задания 14 марта 2019
  • Обществознание 9 класс тренировочная работа №1 ответы и задания 21.09
  • ОБЩЕСТВОЗНАНИЕ для 9 классов Республика Коми, 11 регион
  • Обществознание ОГЭ 2018 платно
  • ОГЭ
  • ОГЭ 2017 закрытый раздел
  • ОГЭ 2018 Математика платно
  • ОГЭ 2019 география 9 класс ответы для 24 региона
  • ОГЭ 2019 география 9 класс ответы для 54 региона
  • ОГЭ 2019 официальное расписание экзаменов 9 класс
  • ОГЭ английский язык 2018 ответы и задания 9 класс
  • Одно желание было у лейтенанта Бориса Костяева готовые сочинения ЕГЭ
  • Окружающий мир 4 класс ВПР 2018 ответы и задания
  • Окружающий мир 4 класс демоверсия ВПР 2020 задания и ответы ФИПИ
  • Олимпиада Звезда заключительный тур 2017-2018 задания и ответы
  • Олимпиада Ломоносов по математике 11 класс задания и ответы 2018-2019
  • Олимпиада Наше Наследие 2019-2020 учебный год задания и ответы
  • Олимпиада Наше Наследие 2020-2021 учебный год ОВИО задания и ответы
  • Олимпиада Наше Наследие задания и ответы 2018-2019 учебный год
  • Олимпиада основы православной культуры задания и ответы 2019-2020
  • Олимпиада по английскому языку 8-10 класс ответы и задания для пригласительного этапа 17 апреля 2020
  • Олимпиада по английскому языку задания и ответы муниципального этапа 2019
  • Олимпиада по английскому языку школьный этап 2017 задания
  • Олимпиада по астрономии муниципальный этап 2019 задания и ответы
  • Олимпиада по биологии ответы и задания школьный этап 2019 ВОШ
  • Олимпиада по биологии ответы и задания школьный этап ВсОШ 23-24 октября 2019
  • Олимпиада по математике НТИ отборочный этап ответы и задания 2018-2019
  • Олимпиада по МХК школьный этап 2017 задания
  • Олимпиада по обществознанию школьный этап 2017 задания
  • Олимпиада по праву школьный этап 2017 задания
  • Олимпиада по русскому языку задания и ответы школьного этапа 2019
  • Олимпиада по физической культуре муниципальный этапа 2019-2020 задания и ответы
  • Олимпиада по экологии 4-10 класс ответы и задания для пригласительного этапа 15 апреля 2020
  • Олимпиада по экологии ответы и задания школьный этап 2019-2020 Московская область
  • Олимпиада по экологии школьный этап 2017 задания
  • Олимпиада РОСАТОМ 2018-2019 задания и ответы
  • Олимпиада ФИЗТЕХ 11 класс ответы и задания 2018-2019
  • Олимпиада школьников САММАТ 2019-2020 ответы и задания
  • Олимпиады
  • Оплата заказа
  • Оренбургская область 56 регион задания и ответы работы январь 2018
  • Отборочные задания по математике для физико-математической школы 2019 год
  • Отборочные задания по физике для физико-математической школы 2019 год
  • Ответы 56 регион математика 8 класс 19 декабря 2018
  • Ответы 7 8 класс золотое руно 2019 с заданиями
  • Ответы 9-11 класс золотое руно задания 2019
  • Ответы английский язык 7 8 9 класс говорение 56 регион 2018-2019
  • Ответы английский язык для 9 классов 56 регион
  • Ответы ВПР 2020 по биологии 6 класс задание №5
  • Ответы для реального задания №10 ВПР 2020 по географии 6 класс
  • Ответы для реального задания №9 ВПР 2020 по географии 6 класс
  • Ответы задания и сочинения татарский язык ЕРТ
  • Ответы задания изложение по русскому языку 9 класс СтатГрад 8 февраля 2018
  • Ответы и задания 1-2 класс конкурс АСТРА 20 ноября 2019-2020
  • Ответы и задания 10-11 класс КИТ 2018
  • Ответы и задания 11 класс кенгуру выпускника 2019
  • Ответы и задания 12.04.2018
  • Ответы и задания 2 класс пегас 2019
  • Ответы и задания 2 класс чип 2019-2020 Австралия
  • Ответы и задания 3-4 класс золотое руно 2019
  • Ответы и задания 3-4 класс кенгуру 2019 год
  • Ответы и задания 3-4 класс пегас 2019
  • Ответы и задания 3-4 класс ЧИП 2019 год
  • Ответы и задания 4-5 класс КИТ 2019 конкурс 27 ноября 2019-2020
  • Ответы и задания 4-5 класс русский медвежонок 14 ноября 2019
  • Ответы и задания 5-6 класс Гелиантус (астра) 2018-2019
  • Ответы и задания 5-6 класс золотое руно 2019 год
  • Ответы и задания 6-7 класс КИТ 2019 конкурс 27 ноября 2019-2020
  • Ответы и задания 6-7 класс русский медвежонок 2018-2019
  • Ответы и задания 8-9 класс русский медвежонок 2018-2019
  • Ответы и задания 9 класс кенгуру выпускника 2019
  • Ответы и задания 9-10 класс кенгуру 2019 год
  • Ответы и задания английский язык 9 класс диагностика №2 22 марта 2019
  • Ответы и задания БИ10401 и БИ10402 биология 11 класс 4 марта 2019
  • Ответы и задания биология 11 класс статград
  • Ответы и задания биология 11 класс статград 30 ноября 2018
  • Ответы и задания ВПР по географии 10-11 класс 03.04.2018
  • Ответы и задания география 11 класс статград 9 декабря 2019 ГГ1910201
  • Ответы и задания для конкурса Кенгуру 2020 11 класс
  • Ответы и задания для конкурса по информатике КИТ 1-11 класс 29 ноября 2017 год
  • Ответы и задания для Оренбургской области 56 регион март 2019
  • Ответы и задания для пробных работ 56 региона 2018
  • Ответы и задания для работ 15.02.2017
  • Ответы и задания для работы статград по истории 9 класс
  • Ответы и задания золотое руно 2019 1-2 класс
  • Ответы и задания информатика 11 класс ИН1910101 ИН1910102 23 сентября 2019
  • Ответы и задания история 9 класс статград 29 ноября 2018 год
  • Ответы и задания КДР 23 регион март 2019 год
  • Ответы и задания КДР геометрия 8 класс 16 ноября 2018 года
  • Ответы и задания кенгуру 2 класс 2019 год
  • Ответы и задания кенгуру выпускника 4 класс 2019
  • Ответы и задания контрольная по математике 7 класс
  • Ответы и задания контрольных работ для 56 региона декабрь 2019
  • Ответы и задания МЦКО английский язык 9 класс 2018
  • Ответы и задания ОГЭ 2018 по математике 9 класс
  • Ответы и задания олимпиада звезда по обществознанию 2019-2020 отборочный этап
  • Ответы и задания олимпиады по физкультуре 8,9,10 класс пригласительный этап 28 апреля 2020
  • Ответы и задания по астрономии школьный этап всероссийской олимпиады 2019-2020
  • Ответы и задания по биологии 11 класс 30 января 2018 СтатГрад
  • Ответы и задания по биологии 11 класс статград 12.09
  • Ответы и задания по биологии 9 класс 17.09 статград
  • Ответы и задания по Биологии 9 класс 24 января 2018 СтатГрад
  • Ответы и задания по биологии 9 класс БИ1990101-02 статград 14 октября 2019
  • Ответы и задания по биология 9 класс СтатГрад 2018
  • Ответы и задания по информатике 11 класс статград 14.09
  • Ответы и задания по информатике 9 класс статград 19.09
  • Ответы и задания по информатике 9 класс СтатГрад 31 января 2018
  • Ответы и задания по Истории 11 класс 23 января 2018 СтатГрад
  • Ответы и задания по истории 11 класс ИС1910101 ИС1910102 27 сентября 2019
  • Ответы и задания по истории 9 класс 18 января 2018 СтатГрад
  • Ответы и задания по истории школьный этап всероссийской олимпиады школьников 2019-2020
  • Ответы и задания по итальянскому языку школьный этап всероссийской олимпиады 2019-2020
  • Ответы и задания по китайскому языку олимпиада школьный этап 2019-2020
  • Ответы и задания по литературе школьный этап всероссийской олимпиады 2019-2020 московская область
  • Ответы и задания по математике 10 класс контрольная работа
  • Ответы и задания по математике 11 класс 25 января 2018 СтатГрад
  • Ответы и задания по математике 11 класс ЕГЭ база 56 регион 04.04.18
  • Ответы и задания по математике 11 класс мониторинговая работа 2019-2020
  • Ответы и задания по математике 8 класс статград 11.09
  • Ответы и задания по математике 9 класс 12 декабря 2019 статград все варианты
  • Ответы и задания по математике 9 класс 56 регион 4 декабря 2018
  • Ответы и задания по математике 9 класс МА1990101-МА1990104 3 октября 2019
  • Ответы и задания по математике школьный этап 2019-2020 всероссийская олимпиада
  • Ответы и задания по математике школьный этап 2019-2020 всероссийской олимпиады
  • Ответы и задания по МХК искусство всероссийская олимпиада школьный этап 2019-2020
  • Ответы и задания по ОБЖ всероссийская олимпиада 2018-2019
  • Ответы и задания по ОБЖ школьный этап всероссийской олимпиады школьников 2019-2020
  • Ответы и задания по обществознанию 11 класс ОБ10101 ОБ10102 статград 2018-2019
  • Ответы и задания по обществознанию 9 класс 26 января 2018 СтатГрад
  • Ответы и задания по обществознанию ОГЭ 2018
  • Ответы и задания по праву муниципальный этап 11 ноября всероссийской олимпиады 2018-2019
  • Ответы и задания по русскому языку 11 класс 19 января 2018 СтатГрад
  • Ответы и задания по русскому языку 11 класс 2 октября 2019 РУ1910101 РУ1910102
  • Ответы и задания по Русскому языку 11 класс статград 28 марта 2018
  • Ответы и задания по русскому языку 7 класс входная работа
  • Ответы и задания по русскому языку 8 класс 56 регион
  • Ответы и задания по русскому языку 9 класс МЦКО 1 октября 2019
  • Ответы и задания по русскому языку 9 класс статград РУ1990101-02 16 октября 2019
  • Ответы и задания по Русскому языку КДР 11 класс январь 2019
  • Ответы и задания по русскому языку муниципальный этап 11 ноября всероссийской олимпиады 2018-2019
  • Ответы и задания по русскому языку ОГЭ 2018
  • Ответы и задания по русскому языку олимпиада школьный этап 22 октября 2019
  • Ответы и задания по физике 10 класс КДР 30 января 2018
  • Ответы и задания по физике 11 класс ВОШ 2018-2019
  • Ответы и задания по физике 11 класс ВПР 2018 10.04.18
  • Ответы и задания по физике 11 класс КДР 30 января 2018
  • Ответы и задания по физике 9 класс 29 января 2018 СтатГрад
  • Ответы и задания по физике 9 класс КДР 30 января 2018
  • Ответы и задания по физике 9 класс статград
  • Ответы и задания по физике школьный этап всероссийской олимпиады 2019-2020
  • Ответы и задания по химии 11 класс 28 ноября 2018
  • Ответы и задания по химии 11 класс ВПР 2018 05.04.18
  • Ответы и задания по химии 11 класс статград ХИ1910101 и ХИ1910102 15 октября 2019
  • Ответы и задания по химии 9 класс статград ХИ1990101-ХИ1990104 21 октября 2019
  • Ответы и задания по химии 9 класс тренировочная работа статград
  • Ответы и задания по экологии школьный этап всероссийской олимпиады школьников 2019-2020
  • Ответы и задания русский язык 11 класс варианты 16 мая 2019 год
  • Ответы и задания русский язык 7 класс ВПР 9 апреля 2019 год
  • Ответы и задания русский язык 9 класс 56 регион 06.04.18
  • Ответы и задания стартовая работа русский язык 8 класс 23 сентября 2019
  • Ответы и задания статград обществознание 11 класс 14 декабря 2018
  • Ответы и задания статград по физике 9 класс варианты 24 октября 2019
  • Ответы и задания тренировочная №4 история 9 класс 21 марта 2019
  • Ответы и задания ФИ90401 и ФИ90402 физика 9 класс 4 марта 2019
  • Ответы и задания Физика ОГЭ 2018 9 класс
  • Ответы и задания ЧИП 1-2 класс 2019
  • Ответы и задания школьный этап по математике всероссийской олимпиады новосибирская область 2019-2020
  • Ответы и задания школьный этап по физике всероссийской олимпиады в Московской области 2019-2020
  • Ответы КДР 2019 по информатике 10 класс 15 марта 23 регион
  • Ответы КДР 2019 по информатике 9 класс 15 марта 23 регион
  • Ответы КДР 2019 по литературе 10 класс 15 марта 23 регион
  • Ответы КДР 2019 по литературе 9 класс 15 марта 23 регион
  • Ответы КДР 23 регион биология 11 класс 21.12.2018
  • Ответы КДР 23 регион история 11 класс 21.12.2018
  • Ответы КДР задания 23 регион Февраль 2019 год
  • Ответы КДР литература 11 класс 14 декабря 2018
  • Ответы КДР физика 11 класс 14 декабря 2018
  • Ответы МЦКО математика 10 класс 5 декабря 2018
  • Ответы МЦКО математика 11 класс 28 ноября 2018
  • Ответы МЦКО по истории 9 класс 19.09
  • Ответы на тренировочная работа по химии 9 класс «СтатГрад»
  • Ответы на тренировочную работу по русскому языку 11 класс
  • Ответы обществознание 9 класс статград 5 декабря 2018
  • Ответы обществознание для 10 классов 23 регион
  • Ответы ОГЭ 2018 английский язык
  • Ответы ОГЭ 2018 русский язык
  • Ответы олимпиада по праву 9 класс школьный этап ВОШ 2018-2019
  • Ответы олимпиада по физике 9 класс 2018-2019
  • Ответы по английскому языку 7-9 класс 56 регион 10.12.2018 Аудирование
  • Ответы по английскому языку олимпиада ВОШ школьный этап 2018-2019
  • Ответы по астрономии школьный этап олимпиады ВОШ 2018-2019
  • Ответы по биологии 9 10 11 класс вош 2018-2019 школьный этап
  • Ответы по биологии для 9 классов (Оренбургская область, 56 регион)
  • Ответы по географии ВОШ олимпиада школьный этап 2018-2019
  • Ответы по географии для 9 классов 11 регион
  • Ответы по информатике 11 класс 12.05
  • Ответы по искусству МХК олимпиада ВОШ школьный этап 2018-2019
  • Ответы по истории 11 класс статград тренировочная работа №1 26.09
  • Ответы по истории 11 класс школьный этап олимпиады ВОШ 2018-2019
  • Ответы по истории 9 класс статград
  • Ответы по истории для 9 классов (Оренбургская область, 56 регион)
  • Ответы по математике 7-8 класс КДР
  • Ответы по математике 8 класс МЦКО 28 марта 2018
  • Ответы по математике 9 класс 64 регион
  • Ответы по математике 9 класс СтатГрад 15.02
  • Ответы по немецкому языку 7-9 класс 56 регион 10.12.2018 Аудирование
  • Ответы по русскому языку 11 класс 11 регион 13.02
  • Ответы по русскому языку для 7 и 8 класс 12.05
  • Ответы по русскому языку школьный этап олимпиады ВОШ 2018-2019
  • Ответы по тренировочная работа по биологии 11 класс
  • Ответы по тренировочная работа по обществознанию 9 класс
  • Ответы по физике 9 класс ФИ90201 и ФИ90202 статград 7 декабря 2018
  • Ответы по физике, биологии для 11 классов 56 регион 16.02
  • Ответы по химии 11 класс пробное ЕГЭ статград 12 марта 2019
  • Ответы по химии 9 класс статград 19 декабря 2018
  • Ответы по химии, информатике, географии, обществознанию для 9 классов
  • Ответы по экологии школьный этап ВОШ 2018-2019
  • Ответы репетиционный экзамен по математике 9 класс пробное ОГЭ 9 февраля 2018
  • Ответы РПР по математике 9 класс 64 регион 3 этап 2018
  • Ответы русский язык 10 класс 56 регион 12.05
  • Ответы русский язык 5-8 класс контрольная работа за 1 полугодие 56 регион 2018
  • Ответы статград география 11 класс 11.12.2018
  • Ответы СтатГрад по обществознанию 9 класс
  • Ответы статград по обществознанию 9 класс варианты ОБ1990101-02 23 октября 2019
  • Ответы тренировочная работа по истории 9 класс
  • Ответы тренировочная работа по математике 10 класс 08.02.2017
  • Ответы тренировочная работа по русскому языку 9 класс 09.02.2017
  • Ответы тренировочная работа по химии 11 класс 14.02
  • Ответы физике для 9 классов (Оренбургская область, 56 регион)
  • Отзывы прошлых лет
  • Отзывы с первого экзамена ОГЭ 2018 по английскому языку
  • Отзывы с первых экзаменов ЕГЭ 2017
  • Отзывы с прошедших экзаменов ОГЭ 2019
  • Отзывы с экзамена по русскому языку ОГЭ 2018
  • Открытый банк заданий и ответы ФИПИ ЕГЭ 2019 по русскому языку 11 класс
  • Официальные работы РДР 2019-2020 для 78 региона
  • Официальные работы РДР для 78 региона 2018-2019 учебный год
  • Официальные РДР 2020 для Московской области задания и ответы
  • Официальные РДР 2021 для Московской области задания и ответы
  • Официальные темы для Республика Саха (Якутия) Сахалинская область итоговое сочинение 2018-2019
  • Официальные темы итогового сочинения 2018-2019 11 класс для часового пояса MSK+1
  • Официальные темы итогового сочинения 2018-2019 11 класс для часового пояса MSK+6
  • Официальные темы итогового сочинения 2018-2019 11 класс для часового пояса МСК
  • Официальные темы итогового сочинения 2018-2019 для часового пояса MSK +9
  • Официальные темы итогового сочинения 2018-2019 для часового пояса MSK+7
  • Оформление заказа
  • Пегас 2018 задания и ответы 7 февраля конкурс по литературе
  • Пегас 2019 5-6 класс ответы и задания
  • Пегас 2019 7-8 класс ответы и задания
  • Пегас 2019 ответы для 9-11 класса
  • Письмо английский язык 7 8 9 класс 56 регион ответы и задания
  • Платно русский язык 9 класс
  • Поддержать проект
  • Полугодовая контрольная работа по русскому языку 11 класс задания и ответы 2019-2020
  • ПОЛЬЗОВАТЕЛЬСКОЕ СОГЛАШЕНИЕ
  • Предэкзаменационная работа задания и ответы по информатике 9 класс ОГЭ 2019
  • Предэкзаменационная работа задания и ответы по математике 11 класс ЕГЭ 2019
  • Пригласительный школьный этап 2021 всероссийская олимпиада школьников задания и ответы
  • Пробная (тренировочная) ВПР 2019 география 10-11 класс ответы и задания
  • Пробное (тренировочное) ВПР 2019 биология 11 класс ответы и задания
  • Пробное (тренировочное) ВПР 2019 география 6 класс ответы и задания
  • Пробное (тренировочное) ВПР 2019 математика 7 класс ответы и задания
  • Пробное (тренировочное) ВПР 2019 русский язык 4 класс ответы и задания
  • Пробное (тренировочное) ВПР 2019 русский язык 5 класс ответы и задания
  • Пробное (тренировочное) ВПР 2019 русский язык 6 класс ответы и задания
  • Пробное ВПР 2019 ответы и задания по английскому языку 11 класс
  • Пробное ВПР 2019 ответы и задания по биологии 5 класс
  • Пробное ВПР 2019 ответы и задания по биологии 7 класс
  • Пробное ВПР 2019 по истории 5 класс ответы и задания
  • Пробное ВПР 2019 по истории 6 класс ответы и задания
  • Пробное ВПР 2019 по химии 11 класс ответы и задания
  • Пробное Итоговое собеседование 9 класс русский язык ОГЭ 2019 задания
  • Пробный экзамен по обществознанию и литературе для 11 классов ответы
  • Работа по математике 11 класс статград ответы и задания 25 сентября 2019
  • Работа статград по русскому языку 9 класс 3 декабря 2019 ответы и задания
  • Работы (задания+ответы) для Республики Коми Март 2017
  • Работы (задания+ответы) Март 2017 СтатГрад
  • Работы (задания+ответы) Февраль 2017
  • Работы (задания+ответы) Январь 2017
  • Работы 56 регион ответы и задания май 2019 год
  • Работы для 56 региона Май 2018 ответы и задания
  • Работы для Оренбургской области
  • Работы для Республики Коми Декабрь 2017 задания и ответы
  • Работы для Республики Коми Ноябрь 2017 задания и ответы
  • Работы для Республики Коми Октябрь 2017 задания и ответы
  • Работы задания и ответы по регионам
  • Работы МЦКО демоверсии задания и ответы
  • Работы СтатГрад 2018 февраль задания и ответы
  • Работы СтатГрад апрель 2018 задания и ответы
  • Работы Статград ВПР задания и ответы февраль 2019
  • Работы статград ВПР март 2019 задания и ответы
  • Работы СтатГрад декабрь 2017 задания и ответы
  • Работы статград декабрь 2018-2019 ответы и задания
  • Работы статград декабрь 2019 задания и ответы 2019-2020 учебный год
  • Работы статград задания и ответы ноябрь 2019-2020 учебный год
  • Работы СтатГрад задания и ответы октябрь 2018
  • Работы статград задания и ответы октябрь 2019-2020 учебный год
  • Работы СтатГрад задания и ответы сентябрь 2018
  • Работы СтатГрад март 2018 задания и ответы
  • Работы СтатГрад ноябрь 2017 задания и ответы
  • Работы СтатГрад октябрь 2017 задания и ответы
  • Работы СтатГрад сентябрь 2017 задания и ответы
  • Работы статград сентябрь 2019 год ответы и задания
  • Работы СтатГрад январь 2018 задания и ответы
  • Работы статград январь 2020 задания и ответы 2019-2020 учебный год
  • Работы СтатГрад, КДР за апрель 2017
  • Работы СтатГрад, КДР за май 2017
  • Работы СтатГрад, КДР за март 2017
  • Работы СтатГрад, КДР, тренировочные за февраль 2017
  • Работы СтатГрад, КДР, тренировочные за январь 2017
  • Расписание
  • Расписание ГИА ОГЭ 2017
  • Расписание ЕГЭ 2018 досрочный основной резервный период
  • Расписание итогового сочинения 2017-2018
  • Расписание проведения экзаменов 9 класса ОГЭ 2018
  • Расписание школьных олимпиад 2017-2018 задания и ответы
  • Распределения реальных тем итогового сочинения 2017-2018 по зонам регионам
  • РДР 2019-2020 по физике 10 класс ответы и задания
  • РДР 8 класс ответы и задания по математике 15 ноября 2018
  • РДР математика 10 класс 14 ноября 2019 ответы и задания
  • РДР математика 6 класс ответы и задания 21 ноября 2019 78 регион
  • РДР ответы и задания для Санкт-Петербурга
  • РДР по русскому языку 9 класс ответы и задания вариант 1901 и 1902 17 октября 2019
  • Реальное ВПР 2020 задание 1 по биологии 5 класс с ответами
  • Реальное ВПР 2020 задание 2 по биологии 5 класс с ответами
  • Реальное ВПР 2020 задание №1 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №10 по биологии 5 класс с ответами
  • Реальное ВПР 2020 задание №10 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №11 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №12 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №2 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №3 по биологии 5 класс с ответами
  • Реальное ВПР 2020 задание №3 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №4 по биологии 5 класс с ответами
  • Реальное ВПР 2020 задание №4 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №5 по биологии 5 класс с ответами
  • Реальное ВПР 2020 задание №5 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №6 по биологии 5 класс с ответами
  • Реальное ВПР 2020 задание №6 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №7 по биологии 5 класс с ответами
  • Реальное ВПР 2020 задание №7 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №8 по русскому языку 5 класс с ответами
  • Реальное ВПР 2020 задание №9 по русскому языку 5 класс с ответами
  • Реальные задания по математике ПРОФИЛЬ ЕГЭ 2018
  • Реальные темы и готовые сочинения 4 декабря 2019 ФИПИ для региона МСК+9
  • Реальные темы итогового сочинения 2018-2019 5 декабря
  • Реальный вариант с ЕГЭ 2019 по математике 29 мая 2019 год
  • Региональный экзамен по математике 7 класс
  • Региональный экзамен по математике 7 класс 56 регион ответы и задания
  • Региональный экзамен по русскому языку 8 класс 56 регион
  • Региональный этап 2019 по астрономии задания и ответы всероссийская олимпиада
  • Региональный этап 2019 по географии ответы и задания ВОШ
  • Региональный этап 2019 по искусству МХК ответы и задания ВОШ
  • Региональный этап 2019 по истории задания и ответы всероссийская олимпиада
  • Региональный этап 2019 по немецкому языку задания и ответы
  • Региональный этап по биологии задания всероссийская олимпиада 2018-2019
  • Региональный этап по математике ответы и задания 2019
  • Результаты ЕГЭ 2017 у школьников
  • Решать реальное ВПР 2020 задание №8 по биологии 5 класс с ответами
  • Решать реальное ВПР 2020 задание №9 по биологии 5 класс с ответами
  • Решения и задания муниципального этапа 2019 олимпиады по математике
  • РПР 2017-2020 задания и ответы для Саратовской области 64 регион
  • РПР математика 9 класс 3 этап задания и ответы 2018-2019
  • РПР по математике 9 класс 64 регион задания 2018-2019
  • Русский медвежонок 10-11 класс ответы и задания 2018-2019
  • Русский медвежонок 14 ноября 2019 ответы и задания 6-7 класс
  • Русский медвежонок 2-3 класс ответы и задания 2018-2019
  • Русский медвежонок 2019 ответы и задания для 10-11 класса 14 ноября
  • Русский Медвежонок 2019 ответы и задания для 2-3 класса
  • Русский медвежонок 2019-2020 ответы и задания 8-9 класс 14 ноября
  • Русский медвежонок 4-5 класс ответы и задания 2018-2019
  • Русский медвежонок для учителей 2020 год задания и ответы
  • Русский язык 10 класс КДР ответы и задания
  • Русский язык 10 класс КДР ответы и задания 19 декабря 2018
  • Русский язык 10 класс ответы и задания 56 регион
  • Русский язык 10 класс ответы МЦКО 8 ноября 2018 год
  • Русский язык 10 класс СтатГрад ответы 12.05
  • Русский язык 10-11 класс ответы и задания 22 апреля 2019 тренировочная №1
  • Русский язык 10-11 класс ответы и задания СтатГрад
  • Русский язык 10-11 класс ответы РЯ10901 и РЯ10902 6 марта 2019
  • Русский язык 11 класс 03.06.2019
  • Русский язык 11 класс 11 ноября 2019 ответы и задания работа статград
  • Русский язык 11 класс 56 регион ответы
  • Русский язык 11 класс диагностическая работа №5 ответы и задания 8 апреля 2019
  • Русский язык 11 класс КДР ответы и задания 19 декабря 2018
  • Русский язык 11 класс контрольная работа в формате ЕГЭ 2 варианта задания и ответы
  • Русский язык 11 класс мониторинговая работа ответы и задания
  • Русский язык 11 класс ответы и задания диагностика 2 статград 18 марта 2019
  • Русский язык 11 класс ответы и задания СтатГрад 17.05
  • Русский язык 11 класс ответы РЯ10601 и РЯ10602 статград 2018-2019
  • Русский язык 11 класс ответы статград 30 января 2019
  • Русский язык 11 класс РЯ1910701-РЯ1910702 статград ответы и задания 11 декабря 2019
  • Русский язык 11 класс статград 24 октября 2019 ответы и задания РЯ1910601-02
  • Русский язык 11 класс статград ЕГЭ ответы и задания
  • Русский язык 11 класс СТАТГРАД ответы и задания 28 февраля
  • Русский язык 11 класс статград ответы и задания вариант РЯ10201 и РЯ10202 07.11.2018
  • Русский язык 11 класс тренировочная работа №1 ответы статград 2018-2019
  • Русский язык 3 класс МЦКО ВСОКО задания итоговая работа 2019
  • Русский язык 4 класс ВПР 2020 демоверсия задания и ответы ФИПИ
  • Русский язык 4 класс задания и ответы мониторинговая работа 2019-2020
  • Русский язык 5 класс демоверсия ВПР 2020 ФИПИ задания и ответы
  • Русский язык 5 класс ответы и задания 21.09
  • Русский язык 6 класс ВПР 2018 ответы и задания
  • Русский язык 6 класс ВПР 2019 ответы и задания 23 апреля
  • Русский язык 6 класс ВПР 2020 демоверсия фипи задания и ответы
  • Русский язык 6 класс статград ответы и задания 2018-2019
  • Русский язык 7 класс 56 регион ответы
  • Русский язык 7 класс 56 регион ответы и задания 15 марта 2018
  • Русский язык 7 класс задания и ответы мониторинговая работа 10 сентября 2019
  • Русский язык 7 класс ответы и задания РУ1970101 и РУ1970102 26 сентября 2019
  • Русский язык 7 класс ответы и задания статград 2018-2019
  • Русский язык 7 класс статград ответы и задания
  • Русский язык 7-8 класс ответы КДР 23 января 2019
  • Русский язык 8 класс 56 регион задания и ответы
  • Русский язык 8 класс КДР ответы и задания 19 декабря 2018
  • Русский язык 8 класс ответы и задания 56 регион
  • Русский язык 8 класс ответы и задания 6 мая 2019 итоговая работа
  • Русский язык 8 класс стартовая работа ответы и задания 24.09
  • Русский язык 8 класс статград ответы и задания
  • Русский язык 9 класс 11.05 ответы
  • Русский язык 9 класс 74 регион ответы
  • Русский язык 9 класс ответы и задания 19 апреля 2019 диагностическая работа №4
  • Русский язык 9 класс ответы и задания варианты 13 мая 2019 год
  • Русский язык 9 класс ответы и задания диагностика статград 15 марта 2019
  • Русский язык 9 класс ответы и задания полугодовая работа 2018-2019
  • Русский язык 9 класс ответы изложение статград 2018-2019
  • Русский язык 9 класс СтатГрад 17.04
  • Русский язык 9 класс СтатГрад задания и ответы
  • Русский язык 9 класс статград ОГЭ ответы и задания 15 марта 2018
  • Русский язык 9 класс СТАТГРАД ответы и задания
  • Русский язык 9 класс статград РЯ90201-РЯ90202 ответы и задания 27.11.
  • Русский язык платно
  • Русский язык школьный этап 2018-2019 ответы и задания Санкт-Петербург
  • Русский язык школьный этап 2019-2020 задания и ответы московская область
  • РЭ по математике 7 класс 24.05 ответы
  • РЭ по русскому языку 7 класс ответы 19.05
  • РЭ по русскому языку 8 класс ответы 24.05
  • СтатГрад
  • Статград 9 класс русский язык ответы и задания 21.12.2018
  • СтатГрад апрель 2017 работы задания и ответы
  • СтатГрад биология 11 класс 14.04.17
  • Статград ВПР работы апрель 2019 ответы и задания
  • СТАТГРАД ВПР февраль 2020 задания и ответы 2019-2020 учебный год
  • Статград география 11 класс ответы и задания март 2018
  • Статград география 9 класс ответы и задания 20 ноября 2018
  • СтатГрад задания и ответы по обществознанию 11 класс 1 февраля 2018 года
  • Статград задания и ответы январь 2018-2019
  • Статград информатика 9 класс 27 ноября 2019 ответы и задания ИН1990201-ИН1990204
  • СтатГрад информатика 9 класс ответы и задания 5 марта 2018
  • Статград история 11 класс 2 варианта ответы и задания 12 марта 2018
  • СтатГрад май 2017 работы задания и ответы
  • СтатГрад математика 11 класс ответы и задания 6 марта 2018
  • Статград Обществознание 11 класс ответы и задания
  • Статград обществознание 9 класс ответы и задания 13 марта 2018
  • СтатГрад обществознание 9 класс ответы и задания 17.05
  • СтатГрад ответы и задания для работ ноябрь 2018
  • СтатГрад ответы и задания по математике 10 класс База и Профиль 7 февраля 2018
  • СтатГрад ответы и задания по русскому языку 11 класс 6 февраля 2018
  • Статград ответы русский язык 11 класс 19.12.2018
  • СтатГрад по математике для 11 классов
  • Статград работы май 2018 ответы и задания
  • Статград работы ответы и задания май 2019
  • СтатГрад русский язык диагностические работы 2017 задания и ответы
  • Темы итогового сочинения 2017
  • Темы на пробное итоговое сочинение для 52 региона
  • Темы по направлениям которые будут итоговое сочинение 2018 6 декабря
  • Тест по русскому языку 4 класс ВПР 2018 ответы и задания
  • Тренировочная работа по биологии 11 класс
  • Тренировочная работа по биологии 9 класс ответы и задания 15 января 2019
  • Тренировочная работа по информатике 11 класс
  • Тренировочная работа по информатике 9 класс ответы
  • Тренировочная работа по математике 10 класс ответы 6 февраля 2019
  • Тренировочная работа по математике 11 класс ответы 06.03
  • Тренировочная работа по химии 11 класс ответы 8 февраля 2019
  • Тренировочная работа статград по географии 11 класс ответы 15.02.2019
  • Тренировочное ВПР 2019 ответы и задания по английскому языку 7 класс
  • Тренировочное ВПР 2019 ответы и задания по биологии 6 класс
  • Тренировочное ВПР 2019 ответы и задания по истории 11 класс
  • Тренировочное ВПР 2019 ответы и задания по математике 6 класс
  • Тренировочное ВПР 2019 ответы и задания по физике 11 класс
  • Тренировочные варианты 200203, 200217, 200302 по химии 11 класс с ответами 2020
  • Тренировочные варианты ВПР 2020 по химии 8 класс ХИ1980101,ХИ1980102
  • Тренировочные варианты ЕГЭ по английскому языку 11 класс задания с ответами
  • Тренировочные варианты ЕГЭ по биологии задания с ответами
  • Тренировочные варианты ЕГЭ по географии 11 класс задания с ответами
  • Тренировочные варианты ЕГЭ по информатике задания с ответами
  • Тренировочные варианты ЕГЭ по истории 11 класс задания с ответами
  • Тренировочные варианты ЕГЭ по литературе 11 класс задания с ответами
  • Тренировочные варианты ЕГЭ по математике 11 класс задания с ответами
  • Тренировочные варианты ЕГЭ по обществознанию 11 класс задания с ответами
  • Тренировочные варианты ЕГЭ по русскому языку задания с ответами
  • Тренировочные варианты ЕГЭ по физике 11 класс задания с ответами
  • Тренировочные варианты ЕГЭ по химии 11 класс задания с ответами
  • Тренировочные варианты КДР 10 класс обществознание 2019
  • Тренировочные варианты ОГЭ по английскому языку 9 класс задания с ответами
  • Тренировочные варианты ОГЭ по биологии 9 класс задания с ответами
  • Тренировочные варианты ОГЭ по географии 9 класс задания с ответами
  • Тренировочные варианты ОГЭ по информатике 9 класс задания с ответами
  • Тренировочные варианты ОГЭ по истории 9 класс задания с ответами
  • Тренировочные варианты ОГЭ по математике 9 класс задания с ответами
  • Тренировочные варианты ОГЭ по обществознанию 9 класс задания с ответами
  • Тренировочные варианты ОГЭ по русскому языку 9 класс задания с ответами
  • Тренировочные варианты ОГЭ по физике 9 класс задания с ответами
  • Тренировочные варианты ОГЭ по химии 9 класс задания с ответами
  • Тренировочные варианты по биологии 10 класс задания с ответами
  • Тренировочные задания МЦКО ВСОКО математика 3 класс 2019
  • Тренировочные работы для 56 региона задания и ответы сентябрь 2018
  • Тренировочные работы для 56 региона Оренбургской области задания и ответы
  • Тренировочные работы по математике статград 2017 задания и ответы
  • Тренировочный вариант 33006757 ЕГЭ по математике профильный уровень с ответами
  • Тренировочный вариант 33006758 ЕГЭ по математике профильный уровень с ответами
  • Тренировочный вариант 33006759 ЕГЭ по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073002 по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073003 по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073004 по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073005 по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073006 по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073007 по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073008 по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073009 по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073010 по математике профильный уровень с ответами
  • Тренировочный вариант ЕГЭ 34073011 по математике профильный уровень с ответами
  • Тренировочный вариант с ответами 200316 по физике 11 класс ЕГЭ 2020
  • Тренировочный варианты №191223 и №191209 по химии 11 класс ЕГЭ 2020
  • Тренировочный ЕГЭ 2020 математика 11 класс профиль задания и ответы
  • Турнир ЛОМОНОСОВ задания и ответы 2018-2019
  • Турнир Ломоносова задания и ответы 2019-2020 учебный год
  • Условия перепечатки материалов | Правообладателям
  • Устная часть английский язык 2018 платно
  • Устное собеседование 2019 официальные варианты 13 февраля
  • Устное собеседование 9 класс 2019
  • Физика 11 класс 7 ноября 2019 статград ответы и задания варианты ФИ1910201-ФИ1910204
  • Физика 11 класс ВПР ответы 25.04
  • Физика 11 класс ответы и задания 6 мая 2019 тренировочная работа №5
  • Физика 11 класс ответы и задания пробник статград 14 февраля 2018
  • Физика 11 класс ответы и задания статград 2018
  • Физика 11 класс ответы и задания ФИ1910101 ФИ1910102 19 сентября 2019
  • Физика 11 класс СтатГрад ответы и задания
  • Физика 11 класс тренировочная ЕГЭ №4 статград ответы и задания 14 марта 2019
  • Физика 7 класс ВПР 2019 ответы и задания 23 апреля
  • Физика 9 класс задания и ответы СтатГрад
  • Физика 9 класс ответы и задания ФИ90101 и ФИ90102 статград 2018-2019
  • Физика 9 класс ответы и задания ФИ90401 ФИ90402 статград
  • Физика 9 класс СтатГрад 03.05 ответы
  • Физика 9 класс статград ответы и задания 10 декабря 2019 варианты ФИ1990201-ФИ1990204
  • Физика ОГЭ 2018 ответы и задания 2 июня
  • Физика ОГЭ 2018 платно
  • Физика турнир Ломоносова задания 2018-2019
  • Физическая культура 10 ноября задания муниципальный этап всероссийская олимпиада 2018-2019
  • ФИПИ открытый банк заданий ЕГЭ 2019 по русскому языку Лексика и фразеология
  • Французский язык 7-11 класс муниципальный этап 2019-2020 ответы и задания Москва
  • Химия 11 класс 10.05 СтатГрад ответы
  • Химия 11 класс ВПР 27.04 задания и ответы
  • Химия 11 класс ЕГЭ статград ответы и задания 14 марта 2018
  • Химия 11 класс ответы для ХИ10101 ХИ10102 статград 19.10
  • Химия 11 класс ответы и задания 28 ноября 2019 статград ХИ1910201-ХИ1910204
  • Химия 11 класс ответы и задания варианты статград 13 мая 2019 год
  • Химия 11 класс ответы и задания СтатГрад 9 февраля 2018 года
  • Химия 11 класс СтатГрад задания и ответы
  • Химия 9 класс задания и ответы СтатГрад
  • Химия 9 класс КДР ответы и задания 15 февраля 2018 года
  • Химия 9 класс ОГЭ 4 июня 2019 год
  • Химия 9 класс ОГЭ статград ответы и задания 15 февраля 2018
  • Химия 9 класс ответы и задания 16.05
  • Химия 9 класс ответы и задания ОГЭ статград 22.03.2018
  • Химия 9 класс ответы тренировочная №4 статград 20 марта 2019
  • Химия 9 класс статград ОГЭ ответы и задания
  • Химия ВОШ школьный этап ответы и задания 2018-2019
  • Химия ответы и задания для школьного этапа всероссийской олимпиады 2019-2020
  • Частная группа
  • ЧИП Австралия 23 октября 2019 ответы и задания 7-8 класс
  • ЧИП Австралия 3-4 класс ответы и задания 23 октября 2019-2020
  • ЧИП Австралия ответы и задания 5-6 класс 23 октября 2019-2020
  • ЧИП мир сказок 2019 ответы и задания для 1 класса 5-7 лет
  • Читательская грамотность 4 класс МЦКО 2019 тестирование
  • Чтение читательская грамотность 3 класс МЦКО ВСОКО задания 2019
  • Школьные конкурсы расписание 2017-2018
  • Школьные олимпиады и конкурсы 2017-2018 задания и ответы
  • Школьный тур наше наследие 7-8 класс ответы и задания 2019-2020
  • Школьный этап 2019-2020 всероссийская олимпиада по астрономии ответы и задания
  • Школьный этап 2019-2020 олимпиады ВОШ по физике ответы и задания
  • Школьный этап 2019-2020 по биологии ответы и задания всероссийской олимпиады школьников
  • Школьный этап 2019-2020 по испанскому языку ответы и задания всероссийской олимпиады
  • Школьный этап 2019-2020 по праву задания и ответы для всероссийской олимпиады школьников
  • Школьный этап 2019-2020 по праву ответы и задания всероссийской олимпиады школьников
  • Школьный этап 2019-2020 по русскому языку ответы и задания всероссийская олимпиада школьников
  • Школьный этап ВОШ 2019-2020 ответы и задания по французскому языку
  • Школьный этап ВОШ по информатике ответы и задания 2018-2019
  • Школьный этап ВОШ по испанскому языку ответы и задания 2018-2019
  • Школьный этап ВОШ по математике задания и ответы 2018-2019
  • Школьный этап ВСЕРОССИЙСКИХ олимпиад 2017-2018 задания
  • Школьный этап всероссийской олимпиады задания и ответы по обществознанию 2019-2020 учебный год
  • Школьный этап всероссийской олимпиады задания и ответы по физической культуре 2019-2020
  • Школьный этап ВсОШ 2019-2020 ответы и задания по обществознанию
  • Школьный этап олимпиады по информатике ответы и задания всероссийской олимпиады 2019
  • Школьный этап олимпиады по математике ответы и задания всероссийской олимпиады 2019
  • Школьный этап олимпиады по экономике ответы и задания всероссийской олимпиады 2019
  • Школьный этап по английскому языку 2019-2020 задания и ответы московская область
  • Школьный этап по ОБЖ задания и ответы всероссийская олимпиада 2019-2020
  • Экзамен по географии ОГЭ 2019
  • Экономика олимпиада муниципальный этап 2019 ВсОШ задания и ответы

Сайт МОУ "СОШ № 30" г. Сыктывкара

Федеральные нормативные акты

Приказ Рособрнадзора  от 29.01.2019 № 84 "О проведении Федеральной  службой по надзору в сфере образования и науки мониторинга качества подготовки обучающихся общеобразовательных организаций в форме национальных исследований качества образования и всероссийских проверочных работ в 2019 году"  ОЗНАКОМИТЬСЯ


Республиканские нормативные акты

Приказ Министерства образования, науки и молодежной политики Республики Коми от 01.02.2019 № 74 "Об участии Республики Коми во всероссийских мониторинговых исследованиях качества образования в 2019 году"  ОЗНАКОМИТЬСЯ


Муниципальные нормативные акты

Приказ Управления образования администрации МО ГО "Сыктывкар" от 05.02.2019 № 96 "Об организации исполнения приказа Министерства образования, науки и молодежной политики Республики Коми от 01.02.2019г. № 74 «Об участии Республики Коми во всероссийских мониторинговых исследованиях качества образования в 2019 году»" ОЗНАКОМИТЬСЯ

Приложение № 1к приказу Управления образования администрации МО ГО «Сыктывкар» от «05» февраля 2019г. № 96 "ГРАФИК проведения всероссийских проверочных работ в 2019 году, утвержденный приказом Федеральной службы по надзору в сфере образования и науки от 29.01.2019 № 84" ОЗНАКОМИТЬСЯ


Материалы ВПР

На сайте ФИОКО (https://fioco.ru/obraztsi_i_opisaniya_vpr_2021) размещены образцы и описания проверочных работ для проведения Всероссийских проверочных работ в 2021 году в 11 классах.

Информационные материалы по Всероссийским проверочным работам 2019 года (ВПР-2019) ОЗНАКОМИТЬСЯ

На сайте Федерального института педагогических измерений (http://fipi.ru/vpr) для ознакомления опубликованы описания и образцы вариантов Всероссийских проверочных работ 2018 года для учащихся 11 классов.

  • Образец проверочной работы по математике. 4 класс. 2019 г.
  • Описание проверочной работы по математике. 4 класс. 2019 г.
  • Образец проверочной работы по русскому языку. 4 класс. 2019 г.
  • Описание проверочной работы по русскому языку. 4 класс. 2019 г.
  • Образец проверочной работы по окружающему миру. 4 класс. 2019 г.
  • Описание проверочной работы по окружающему миру. 4 класс. 2019 г.
  • Образец проверочной работы по математике. 5 класс. 2019 г.
  • Описание проверочной работы по математике. 5 класс. 2019 г.
  • Образец проверочной работы по русскому языку. 5 класс. 2019 г.
  • Описание проверочной работы по русскому языку. 5 класс. 2019 г.
  • Образец проверочной работы по биологии. 5 класс. 2019 г.
  • Описание проверочной работы по биологии. 5 класс. 2019 г.
  • Образец проверочной работы по истории. 5 класс. 2019 г.
  • Описание проверочной работы по истории. 5 класс. 2019 г.
  • Образец проверочной работы по математике. 6 класс. 2019 г.
  • Описание проверочной работы по математике. 6 класс. 2019 г.
  • Образец проверочной работы по русскому языку. 6 класс. 2019 г.
  • Описание проверочной работы по русскому языку. 6 класс. 2019 г.
  • Образец проверочной работы по биологии. 6 класс. 2019 г.
  • Описание проверочной работы по биологии. 6 класс. 2019 г.
  • Образец проверочной работы по истории. 6 класс. 2019 г.
  • Описание проверочной работы по истории. 6 класс. 2019 г.
  • Образец проверочной работы по обществознанию. 6 класс. 2019 г.
  • Описание проверочной работы по обществознанию. 6 класс. 2019 г.
  • Образец проверочной работы по географии. 6 класс. 2019 г.
  • Описание проверочной работы по географии. 6 класс. 2019 г.
  • Образец проверочной работы по математике. 7 класс. 2019 г.
  • Описание проверочной работы по математике. 7 класс. 2019 г.
  • Образец проверочной работы по русскому языку. 7 класс. 2019 г.
  • Описание проверочной работы по русскому языку. 7 класс. 2019 г.
  • Образец проверочной работы по биологии. 7 класс. 2019 г.
  • Описание проверочной работы по биологии. 7 класс. 2019 г.
  • Образец проверочной работы по истории. 7 класс. 2019 г.
  • Описание проверочной работы по истории. 7 класс. 2019 г.
  • Образец проверочной работы по обществознанию. 7 класс. 2019 г.
  • Описание проверочной работы по обществознанию. 7 класс. 2019 г.
  • Образец проверочной работы по географии. 7 класс. 2019 г.
  • Описание проверочной работы по географии. 7 класс. 2019 г.
  • Образец проверочной работы по английскому языку. 7 класс. 2019 г.
  • Описание проверочной работы по английскому языку. 7 класс. 2019 г.
  • Образцы и описания проверочных работ для проведения ВПР в 11 классах. 2019 г.

Интернет ресурсы

https://vpr.statgrad.org/

http://old.prosv.ru/info.aspx?ob_no=45677

http://www.fipi.ru/vpr

Д-р Р.К. Малхотра, генеральный директор ФИПИ: ваше путешествие в нефтегазовую отрасль - Insights

В индийском энергетическом ландшафте и нарративе Федерация нефтяной промышленности Индии (FIPI) является наиболее эффективным и влиятельным голосом. С момента своего создания организация была в авангарде развития отрасли в Индии как глобально конкурентоспособного сектора и, таким образом, зарабатывала огромное признание и уважение общества. Когда отрасль переживает спад или потрясения, которые проявляются во всех формах - иногда ожидаемых, а иногда совершенно беспрецедентных, роль таких посредников действует как путеводный свет.То, что перед нами сегодня, - это то, чего отрасль никогда раньше не испытывала - пандемия COVID 19. Индия находится в фазе блокировки 5 или разблокировки 1.0, и в отрасли происходят изменения, на которые мы все приковываем внимание. Без сомнения, мы должны приложить все усилия в этой неизведанной местности.

«ФИПИ представляет нефтегазовую отрасль Индии в государственных органах, комитетах и ​​рабочих группах и от имени отрасли представляет рекомендации правительству по различным вопросам.”

Это также время вспомнить и поделиться историями о стойкости и смелости, инновациях и вдохновении, творчестве и сотрудничестве. Именно в такие времена нам нужно узнавать о людях, которые внесли значительный вклад, и продолжать это делать. Именно во время ADIPEC 2019 у меня появилась возможность поговорить с доктором Р.К. Малхотра, генеральный директор, Федерация нефтяной промышленности Индии - ФИПИ. Узнавать о его уникальном пути в отрасли и его мыслях по важным вопросам, связанным с этим постоянно развивающимся сектором, было большим опытом.Вот основные моменты нашего разговора.

В разговоре с доктором Р.К. Мальхотра, генеральный директор, FIPI
Мы обсуждаем нефть и газ 4.0. Цифровизация стала неотъемлемой частью нефтегазовой экосистемы. Как вы смотрите на этот переход?

Я с нетерпением жду цифровизации с точки зрения повышения эффективности и повышения производительности.

Подключенные активы и малые предприятия даже в переработке, независимо от того, занимаетесь ли вы маркетингом или переработкой помимо добычи, везде цифровизация может помочь повысить эффективность, производительность, экономию, сократить расходы на техническое обслуживание, сократить производственные затраты, а также повысить безопасность, что является наиболее важным.Так что я очень надеюсь на цифровизацию.

Как вы относитесь к сотрудничеству в отрасли?

Сотрудничество очень важно. Отрасль должна работать в духе сотрудничества. Некоторые знания, полученные в одной компании, должны быть реализованы в другой. В частности, в Индии, где очень много компаний государственного сектора. Они тоже работают по-своему. Что бы ни разработала одна компания, выгоду нужно передать другой. 1 +1 всегда 11, поэтому я считаю, что если есть синергия и люди будут сотрудничать в некоторых конкретных областях исследований, результаты могут быть быстрее. Инновационная выгода может переходить от одной компании к другой, и этот сектор может получить выгоду.

Если компании в Индии будут сотрудничать, выиграют все.

Какие препятствия вы видите на пути цифровизации?

Бывают случаи, когда вам нужно делать вложения, и вы не можете сразу рассчитать выгоду. Высшее руководство должно понимать, что эти инвестиции окупаются в долгосрочной перспективе, и чем раньше вы это сделаете, тем раньше вы получите выгоду.

Все дело в мышлении людей. И еще одно препятствие - это некоторые старые активы, такие как старые нефтеперерабатывающие заводы, старые производственные блоки, их может быть сложно реализовать. В основе лежит знание. Вы должны переучивать людей, переквалифицировать их, чтобы принимать это на высшем и среднем уровнях. Молодежь будет в восторге от этого. Они узнали все о цифровизации во время обучения, но высшее руководство и пожилые люди должны быть убеждены в преимуществах, и они должны понимать, что эти инвестиции того стоят, и они принесут вам доход и повышенную эффективность.Как только это осознание придет, это будет легко.

Как вы смотрите на большую смену экипажа в нефтегазовой отрасли? Как старшие специалисты передают знания подрастающему поколению?

Я особенно думаю, что молодое поколение должно учиться у своих старших и их опыта, и в то же время есть чему поучиться у молодого поколения. Будучи пожилым человеком, я не говорю, что мне нечему учиться и что я могу только передавать знания.Я думаю, мне есть чему поучиться у молодежи. Молодые люди намного умнее, они стали свидетелями цифровизации. Они цифровые аборигены. В наших домах мы также зависим от наших детей. У нас дома есть устройства, и когда нам нужно их перезагрузить, мы спрашиваем об этом у наших детей. Точно так же и в организациях молодые люди могут рассказывать о преимуществах цифровизации, новых технологий и о том, как технологии могут ускорить инновационный процесс. А пожилые люди могут рассказать о своем опыте.

Я думаю, что это хорошая смесь, что-то перетекает сверху вниз, что-то снизу вверх, я думаю, что эта комбинация может быть смертельной комбинацией.И вся организация может получить выгоду.

Ни один старший не должен думать, что младший не знает, а я знаю все, и в то же время молодежь должна стремиться учиться на опыте старших.

Какой вы видите роль ФИПИ в будущем?

FIPI - голос отрасли.

Как федерация, мы пытаемся объединить всю нефтегазовую отрасль и решаем вопросы, представляющие общий интерес.Иногда у компаний может возникнуть конфликт интересов.

С точки зрения федерации, я смотрю на нее так: сначала нация, затем компания, а затем отдельный человек.

Когда у нас возникают такие конфликтные ситуации, я всегда говорю членам моей команды делать то, что в интересах страны. Интерес страны превыше всего. Если есть противоречивые политики, противоречивые требования, давайте попробуем обдумать и посмотреть, что в интересах страны и что мы будем поддерживать как федерацию.

Как вы оглянетесь на свое путешествие?

О, мне понравилось. Я всю жизнь занимался исследованиями и разработками - создавал инновационные продукты, инновационные процессы, новые технологии, так что это было захватывающее путешествие.

Я начал свою карьеру в качестве стажера инженера, а затем вошел в совет директоров IOCL, крупнейшей индийской коммерческой корпорации, имел возможность быть председателем также в течение короткого времени, прежде чем я вышел на пенсию.

На моей нынешней должности я смотрю на отраслевую картину продукта, поэтому я думаю, что мой исследовательский опыт был полезен для проведения различных исследований и исследований, которые мы проводим по разным темам. Мы можем давать рекомендации о правильных процессах различным заинтересованным сторонам и проводить правильную политику.

(Это отрывок из эксклюзивного интервью с доктором Р.К. Мальхотра, генеральным директором FIPI, и Energy Dais оставляет за собой все права на публикацию.)

Ферментативная активность

не требуется для регуляции TNF-α, опосредованной фосфолипазой D, и заживления миокарда

Abstract

Фосфолипаза D1 является регулятором экспрессии и высвобождения фактора некроза опухоли α при LPS-индуцированном сепсисе и после инфаркта миокарда (MI). Недостаток PLD1 приводит к снижению воспалительного ответа, опосредованного TNF-α, и к увеличению размера инфаркта со снижением сердечной функции через 21 день после ишемического реперфузионного (I / R) повреждения.Дефицит обеих изоформ PLD, PLD1 и PLD2, а также фармакологическое ингибирование ферментативной активности PLD с помощью ингибитора PLD FIPI защищали мышей от артериального тромбоза и ишемического инфаркта мозга. Здесь мы лечили мышей ингибитором PLD FIPI, чтобы проанализировать, защищает ли фармакологическое ингибирование PLD после ишемии миокарда мышей от повреждения сердца. Ингибирование PLD с помощью FIPI приводит к уменьшению миграции воспалительных клеток в пограничную зону инфаркта через 24 часа после экспериментального ИМ у мышей, обеспечивая первое доказательство зависимости миграции иммунных клеток от ферментативной активности PLD.В отличие от мышей с дефицитом PLD1, уровень TNF-α в плазме не изменился после обработки мышей FIPI. Следовательно, размер инфаркта и функция левого желудочка (LV) были сопоставимы у мышей, получавших FIPI, и контрольных мышей через 21 день после инфаркта миокарда. Более того, выживаемость клеток через 24 часа после I / R не изменилась при лечении FIPI. Наши результаты показывают, что ферментативная активность PLD не отвечает за опосредованную PLD передачу сигналов TNF-α и заживление миокарда после повреждения I / R у мышей. Более того, сниженные уровни TNF-α в плазме у мышей с дефицитом PLD1 могут быть ответственны за увеличение размера инфаркта и нарушение сердечной функции через 21 день после инфаркта миокарда.

Ключевые слова: PLD, ферментативная активность, инфаркт миокарда, ишемия, TNF-α

Введение

Фосфолипаза D (PLD) принадлежит к семейству фосфолипаз, которые катализируют расщепление фосфатидилхолина на фосфатидиновую кислоту (PA) и холин. (McDermott et al., 2004), благодаря чему PA сама по себе является очень важным вторичным посредником во многих клеточных процессах (Oude Weernink et al., 2007). Существуют две разные изоформы PLD -PLD1 и PLD2-, которые имеют 50% гомологичную последовательность (Kodaki and Yamashita, 1997) и повсеместно экспрессируются в разных клетках млекопитающих.Oude Weernink et al. показали, что активность обеих изоформ сильно различается. PLD1 имеет низкую базальную активность и активируется членами семейства Rho (RhoA, Rac1) и протеинкиназой C (PKC). Напротив, PLD2 проявляет высокую базальную активность, и его активация лишь незначительно индуцируется разными активаторами (Oude Weernink et al., 2007).

Активация тромбоцитов способствует активности PLD с помощью различных белков, активирующих тромбоциты, таких как коллаген и тромбин (Martinson et al., 1995; Vorland and Holmsen, 2008).PLD1 играет важную роль в GPIb-зависимой активации интегрина и клеточной адгезии (Elvers et al., 2010). Потеря PLD1 защищает мышей от артериального тромбоза и ишемического инфаркта головного мозга, в то время как дефицит PLD2 не влияет на активацию тромбоцитов (Thielmann et al., 2012). PLD1 также участвует в опосредованном тромбоцитами воспалении. Недавно было показано, что PLD1 необходим для взаимодействия тромбоцитов с эндотелиальными клетками и рекрутирования лейкоцитов при воспалительных процессах. PLD1 поддерживает активацию интегрина α IIb β 3 и прочную адгезию тромбоцитов и лейкоцитов к воспаленному эндотелию в условиях высокого сдвига (Klier et al., 2017). Влияние PLD1 на воспалительные заболевания было также показано при перитоните (Sethu et al., 2010) и раке (Gomez-Cambronero, 2010). Более того, PLD играет роль в ишемии миокарда и реперфузионном повреждении (Schonberger et al., 2014). Потеря PLD1 снижает повышение цитокинов острой фазы, включая TNF-α, и миграцию воспалительных клеток в пограничную зону инфаркта через 24 часа после ишемии. Более того, дифференцировка миофибробластов и отложение интерстициального коллагена были изменены у мышей Pld1 - / - , указывая на важную роль PLD1 в секреции TGF-β и экспрессии α-SMA сердечными фибробластами.Следовательно, размер инфаркта увеличился и сердечная функция была нарушена через 28 дней после ишемии миокарда у мышей Pld1 - / - , что указывает на то, что PLD1 имеет решающее значение для TNF-α-опосредованного воспаления и опосредованного TGF-β образования коллагеновых рубцов (Schonberger et al. , 2014).

В тромбоцитах потеря обеих изоформ PLD у мышей Pld1 - / - / Pld2 - / - привела к дефектной активации интегрина и экспозиции P-селектина, индуцированной агонистами, и защищает мышей от тромбоза, индуцированного хлоридом железа ( Тильманн и др., 2012) и инсульта (Stegner et al., 2013). Обработка тромбоцитов и мышей ингибитором PLD FIPI (5-фтор-2-индолил десхлорогалопемид), который, как известно, ингибирует ферментативную активность как PLD1, так и PLD2, приводила к изменению активации тромбоцитов и защиты от травм FeCl 3 и ишемического инсульта, как наблюдали в Pld1 - / - / Pld2 - / - мышей (Stegner et al., 2013). Однако влияние FIPI и ферментативная активность PLD после инфаркта миокарда (ИМ) были полностью неизвестны.Таким образом, мы проанализировали мышей на модели экспериментального ИМ, чтобы выяснить, влияет ли фармакологическое ингибирование PLD на воспалительную реакцию и ремоделирование сердца после повреждения I / R миокарда.

В этом исследовании мы смогли показать, что ферментативная активность PLD не влияет на передачу сигналов TNF-α и заживление миокарда после ишемии и реперфузионного (I / R) повреждения у мышей.

Материалы и методы

Животные

Исследования на животных проводились в соответствии с директивами Европейского парламента по использованию живых животных в научных исследованиях и в соответствии с немецким законодательством о защите животных.Протокол был одобрен Комитетом по уходу за животными Университета Генриха Гейне и администрацией округа Северный Рейн-Вестфалия (LANUV, NRW, AZ 84-02.04.2013.A486).

Мыши, нацеленные на ген, лишенные PLD1 или PLD2, были описаны ранее (Dall’Armi et al., 2010). Обе линии мутантных мышей были скрещены с получением конститутивных мышей Pld1 - / - / Pld2 - / - , и соответствующие однопометники дикого типа были выведены из пар заводчиков. Для анализа влияния ферментативной активности PLD на ишемию миокарда и реперфузионное повреждение проводили лечение мышей C57BL / 6J (Janvier Labs) ингибитором PLD FIPI.Эксперименты проводились на мышах-самцах в возрасте 10–12 недель. Мышей анестезировали кетамином (100 мг / кг Ketavet ® , Pfizer, Берлин, Германия) и ксилацином (5 мг / кг, Xylazin 2% Bernburg, Medistar, Ascheberg, Германия) путем внутрибрюшинной (ip) инъекции перед открытием грудной клетки. для удаления сердца или эвтаназии была проведена шейная дислокация.

Ишемия и реперфузия миокарда у мышей

Для анализа ИМ самцов мышей в возрасте от 10 до 12 недель анестезировали путем внутрибрюшинной инъекции раствора с кетамином (90 мг / кг массы тела) и ксилацином.Ишемию миокарда вызывали перевязкой левой передней нисходящей артерии (ПНА) на 60 мин. Сразу после ишемии внутрибрюшинно вводили 3 мг / кг массы тела FIPI / 4% ДМСО / PBS. Контрольным мышам вводили 4% ДМСО / PBS. Была выбрана концентрация 3 мг / кг ингибитора PLD FIPI, поскольку эта доза должна обеспечивать 20 часов полного ингибирования (Chen et al., 2012). С этой целью FIPI вводили один раз при анализе острой фазы после I / R миокарда (24 ч) у мышей. Более того, инъекции FIPI выполнялись один раз в день до 21 дня после инфаркта миокарда (ИМ), когда мы анализировали мышей в хронической фазе повреждения миокарда.

Через 24 часа после реперфузии площадь ишемии (зона риска) и зона инфаркта (размер инфаркта) определяли путем окрашивания раствором TTC / Evans Blue. Соотношения различных площадей были количественно определены в цифровом виде с помощью видеопланиметрии.

Для анализа размера инфаркта в хронической серии размер инфаркта определяли с помощью одноэтапного окрашивания трихромом по Гомори через 3 недели после реперфузии. После успешного проведения анестезии сердца удаляли, фиксировали в 4% формалине, заливали парафином и делали серийные срезы для окрашивания раствором One Step Trichome Гомори.Размер инфаркта выражали как процент от общей площади левого желудочка (ЛЖ).

Эхокардиографию выполняли в разные моменты времени с помощью ультразвукового аппарата Vevo 2100 (VisualSonics Inc., Торонто, Канада), и различные параметры, например, фракционное сокращение и фракцию выброса, определяли с помощью соответствующего программного обеспечения.

Выделение эмбриональных фибробластов мыши (MEF)

Для выделения эмбриональных фибробластов мыши (MEF) эмбрионы мышей-доноров получали в состоянии E12-14.После удаления головы и субпродуктов зародыш измельчали ​​вручную и разлагали 0,05% трипсином-ЭДТА и энергичным пипетированием три раза в течение 5 минут при 37 ° C. Гомогенную суспензию клеток собирали в среде для культивирования клеток DMEM (Sigma, Дармштадт, Германия), содержащей 10% фетальной телячьей сыворотки (Sigma, Дармштадт, Германия), 1% пенициллин / стрептомицин (Sigma, Дармштадт, Германия), 1% NEAA (Sigma , Дармштадт, Германия), 0,2% гентамицина, и после достижения слияния (3 дня) клетки можно было пассировать или заморозить при -80 ° C или жидком азоте.

Коллагеновое окрашивание срезов сердца

Через двадцать один день после ишемии / реперфузии сердца были взяты, заключены в парафин и приготовлены срезы этих сердец. Образование рубцов анализировали путем окрашивания этих срезов раствором Gomori-, Bouin’s– (Sigma, Дармштадт, Германия) и раствором гематоксилина (Dr. K. Hollborn & Söhne, Лейбциг, Германия). Изображения получали с помощью бинокулярного микроскопа (Nikon SMZ25), оценивали с помощью программного обеспечения Zen2 blue edition (Zeiss) и определяли отношение размера инфаркта к общей площади левого желудочка.

Для определения количества интерстициального коллагена срезы сердца окрашивали красителем Пикросириус красным (Morphisto, Франкфурт-на-Майне, Германия), а интерстициальный коллаген измеряли в процентах по доле площади. Кроме того, для окрашивания ядер использовали раствор Целестин-синий (Sigma, Дармштадт, Германия).

Иммуногистохимия срезов сердца

Через двадцать четыре часа после ишемии / реперфузии сердца были взяты и парафиновые срезы этих сердец были окрашены либо раствором гематоксилина / эозина (HE) (Sigma, Дармштадт, Германия), либо специфичными для иммунных клеток с помощью стрептавидинпероксидазы-иммунофосфата. метод (Дако, Дармштадт, Германия).Посредством окрашивания HE общее количество клеток, мигрировавших в инфарктную область сердца, было подсчитано для каждого поля зрения, и данные представлены на мм 2 . Для специфического анализа иммунных клеток залитые парафином срезы сердца окрашивали антителом против Ly6G для окрашивания нейтрофилов (BD Pharmingen, Гейдельберг, Германия) и антителом против Mac3 для окрашивания моноцитов (BD Pharmingen, Гейдельберг, Германия). В 12 областях пограничной зоны инфаркта были подсчитаны либо Mac3-, либо Ly6G-положительные клетки, и данные представлены на мм 2 .

Для анализа α-SMA-положительных клеток в зоне инфаркта через 21 день после ишемии / реперфузии проводили окрашивание парафиновых срезов α-актином гладких мышц (α-SMA) с использованием антител против α-SMA (Abcam, Cambridge, Соединенное Королевство), пероксидаза хрена кролика в качестве второго антитела (Санта-Крус, Франкфурт-на-Майне, Германия) и реагент диаминобензидин (DAB) (DAKO, Дармштадт, Германия) в качестве хромогена.

Анализ активации расщепленной каспазы-3

Для анализа расщепленных положительных клеток каспазы-3 на срезах сердца через 24 часа после ишемии / реперфузии снова был проведен стрептавидинбиотин-иммунопероксидазный метод путем окрашивания антителом к ​​расщепленной каспазе-3 (Cell Signaling, Франкфурт-на-Майне, Германия).Положительные по каспазе-3 клетки подсчитывали в пограничной зоне инфаркта, и данные представлены на мм 2 .

Для анализа активации каспазы-3 in vitro клетки HL-1 культивировали в среде Claycomb с добавлением 10% фетальной телячьей сыворотки, 100 Ед / мл пенициллина / стрептомицина, 0,1 мМ норэпинефрина и 2 мМ L-глутамина в колбах Т75. покрытые 0,02% желатина и 0,5% фибронектина при 37 ° C и 5% CO 2 в атмосфере. Среду меняли каждые 2 дня, и сливные колбы обрабатывали трипсином и разделяли в соотношении 1: 3 для дальнейшего субкультивирования или подвергали экспериментальным процедурам.Для моделирования ишемии / реперфузии in vitro клетки HL-1 подвергали 2-часовой ишемии и 5-часовой реперфузии с 1 мкМ FIPI или без него. Вкратце, клетки HL-1 высевали на 6-луночные планшеты (600000 клеток на лунку) и оставляли прилипать в течение 24 часов. Чтобы моделировать ишемию, клетки промывали один раз и заражали подкисленным буфером Кребса-Хенселейта с прегазированным N 2 (125 мМ NaCl, 8 мМ KCl, 1,2 мМ KH 2 PO 4 , 1,25 мМ MgSO 4 , 1,2 мМ CaCl 2 , 6.25 мМ NaHCO 3 , 20 мМ HEPES, 5 мМ Na-лактат, pH 6,6) и 0,5% O 2 , 5% CO 2 и 94,5% N 2 при 37 ° C в течение 2 часов в увлажненный инкубатор гипоксической рабочей камеры (Xvivo System, Biospherix, Parish, NY, США). Реперфузию имитировали заменой среды на буфер реперфузии (O 2 -прегазированный буфер Кребса-Хенселейта: 110 мМ NaCl, 4,7 мМ KCL, 1,2 мМ KH 2 PO 4 , 1,25 мМ MgSO 4 , 1,2 мМ CaCl 2 , 25 мМ NaHCO 3 , 20 мМ HEPES 15 мМ глюкоза, pH 7.4) и подвергая клетки воздействию 21% O 2 и 5% CO 2 при 37 ° C в течение 5 часов. В качестве согласованного по времени не-I / R контроля, клетки HL-1 инкубировали в негазированном реперфузионном буфере в неишемических условиях (21% O 2 , 5% CO 2 , 37 ° C) параллельно в течение 7 час FIPI добавляли к соответствующим клеткам сразу после периода ишемии во время реперфузии. После моделирования ишемии / реперфузии клетки лизировали и определение уровня экспрессии каспазы-3 проводили с помощью вестерн-блот-анализа с анти-расщепленной каспазой-3 (Cell Signaling, Франкфурт-на-Майне, Германия) и антителом против GAPDH ( Cell Signaling, Франкфурт-на-Майне, Германия) в качестве контроля.

Иммуноферментный анализ IL-1β / TNF-α (ELISA)

Для количественного определения IL-1β в плазме через 24 часа после инфаркта миокарда гепаринизированную кровь центрифугировали 10 минут в течение 650 g. Отбирали плазму и измеряли количество цитокинов с помощью иммуноферментного анализа, следуя протоколу производителя (DuoSet Mouse IL-1β / IL-1F2 ELISA, R&D Systems, Миннеаполис, Миннесота, США).

Чтобы исследовать высвобождение TNF-α, активность PLD в MEF ингибировали обработкой 1 мкМ FIPI (5-фтор-2-индолил дез-хлоргалопемид, Дармштадт, Германия) в течение 30 минут.После стимуляции MEF 1 мкг / мл LPS (липополисахарид, Sigma, Дармштадт, Германия) в течение различных периодов времени, как указано, количество TNF-α измеряли в супернатанте клеточной культуры с помощью сэндвич-ELISA, следуя протоколу производителя (DuoSet Mouse TNF-α ELISA; R&D Systems, Миннеаполис, Миннесота, США).

FACS-анализ формирования агрегатов тромбоцитов-иммунных клеток

Нулевой, двадцать четыре и семьдесят два часа после инфаркта миокарда образование агрегатов тромбоцитов-иммунных клеток измеряли с помощью проточной цитометрии.Гепаринизированную кровь дважды промывали буфером Тироде, центрифугировали 5 мин при 650 g, и для измерений использовали только гематокрит. Образцы инкубировали с PE- или APC-конъюгированными антителами к тромбоцитам (GPIb-PE, Emfret, Eibelstadt, Германия), нейтрофилам (Ly6G-APC, Biolegend, Кобленц, Германия) и лейкоцитам (CD45-APC, BD Bioscience, Heidelberg, Германия) маркировка. Данные показывают MFI (среднее значение флуоресценции) либо лейкоцитарного, либо нейтрофильного сигнала дважды положительных клеток.

Количественная ПЦР в реальном времени

Для анализа эндогенно экспрессируемых уровней TNF-α, IL-6, Bax, Bcl-xl и Bcl-2 только выделенная общая РНК левого желудочка сердца через 24 ч после ишемии wildtypic, мышей, обработанных FIPI, и мышей Pld1 - / - / Pld2 - / - .Выделение РНК выполняли с помощью системы ReliaPrep RNA Tissue Miniprep (Promega, Mannheim, Germany) в соответствии с протоколом производителя.

Кроме того, уровни TNF-α в LPS-стимулированных MEF от Pld1 + / + - или Pld1 - / - мышей измеряли с помощью qRT-PCR. Для этого MEF стимулировали 1 мкг / мл LPS в течение 12 часов, и РНК выделяли в соответствии с протоколом производителя RNeasy Mini Kit (Qiagen, Hilden, Германия).

Количественная ПЦР в реальном времени выполнялась с использованием Fast Sybr Green Master Mix (Life Technologies, Карлсбад, Калифорния, США) в соответствии с протоколом производителя.Уровень экспрессии мишени был нормализован к уровням экспрессии РНК глицеральдегид-3-фосфатдегидрогеназы (GAPDH) в качестве контроля. После обратной транскрипции была проведена количественная ПЦР-амплификация с использованием следующих олигонуклеотидных праймеров: GAPDH для 'GGTGAAGGCGGTGTGAACG'; GAPDH rev 'CTCGCTCCTGGAAGATGGTG'; IL-6 для 'ACTCGGCAAACCTAGTGCGTTATG'; IL-6 rev 'ACATTCCAAGAAACCATCTGGCTAG'; BAX для 'TGAAGACAGGGGCCTTTTTG'; BAX rev 'AATTCGCCGGAGACACTCG'; Bcl – xl для 'GACAAGGAGATGCAGGTATTGG'; Bcl – xl rev 'TCCCGTAGAGACCACAAAAGT'; Bcl-2 для 'ATGTGTGTGGAGAGCGTCAA'cl-2 rev' CATGCTGGGGCCATATAGTT '; TNF-α для 'GCCCCCATCTGACCCC-TTT'; TNF – α rev 'GGGGCTGGCTCTGTGAGGAA'.

Статистический анализ

Все эксперименты проводили по крайней мере три раза с n, определенным как отдельное животное. Данные представлены как средние значения ± SEM, как указано. Статистический анализ проводился с использованием двустороннего критерия Стьюдента t , где при P <0,05 считалось значимым. Для всех цифр P <0,05, ∗∗ P <0,01 и ∗∗∗ P <0,001.

Результаты

Неизмененный размер инфаркта и сердечная функция после лечения мышей FIPI через 24 часа после инфаркта миокарда

Недавно было показано, что PLD1 играет важную роль в опосредованном TNF-α воспалении и образовании рубцов после инфаркта миокарда у мышей (Schonberger et al. ., 2014). Чтобы исследовать влияние ферментативной активности PLD на процессы повреждения I / R, мы лечили мышей C57BL / 6 FIPI, небольшим обратимым ингибитором PLD, который, как известно, ингибирует ферментативную активность как PLD1, так и PLD2 (Su et al., 2009) и проанализировали мышей на модели I / R миокарда (рисунок). Специфичность и эффективность ингибирования PLD с помощью FIPI уже была подтверждена в различных исследованиях (Su et al., 2009; Dall’Armi et al., 2010; Stegner et al., 2013). После лигирования ПМЖВ в течение 60 минут реперфузия была разрешена в течение 24 часов, и повреждение миокарда оценивалось с помощью окрашивания хлоридом 2,3,5-трифенилтетразолия, чтобы различать метаболически активную и неактивную ткань.Определяли зону ишемии (, зона риска, ) и зону инфаркта (, размер инфаркта ), и соотношения различных зон определяли количественно в цифровом виде с помощью видеопланиметрии. Никаких различий между мышами, получавшими FIPI, и контрольными мышами не наблюдалось (рисунки). Соответственно, сердечная функция, определяемая фракцией выброса, сердечным выбросом и фракционным укорочением, не различалась в обеих группах (рисунок).

FIPI не влияет на размер инфаркта или функцию левого желудочка через 24 часа после инфаркта миокарда в сердцах мышей. (A) Количественный анализ размера инфаркта как процента зоны риска (% Inf / AaR), зоны риска как процента левого желудочка и размера инфаркта как процента левого желудочка не показал различий в сравнение контрольной группы и группы, получавшей FIPI, в левых желудочках, окрашенных TTC, через 24 ч после I / R (контроль n = 12, FIPI n = 13). (B) Репрезентативные фотографии. Синий = здоровая ткань, красный = область риска (AAR), белый = область инфаркта (INF). (C) Эхокардиографический анализ фракции выброса (исходный уровень по сравнению с 24 ч после I / R), сердечного выброса (исходный уровень по сравнению с 24 ч после I / R) и фракционного укорочения (исходный уровень по сравнению с 24 ч после I / R) Мыши C57BL6 / J, получавшие FIPI (3 мг / кг массы тела в 4% ДМСО / PBS), по сравнению с контрольными не показали никаких различий (контроль n = 20, FIPI n = 23).

Ферментативная активность PLD необходима для миграции воспалительных клеток в пограничную зону инфаркта через 24 часа после MI

Затем мы исследовали миграцию воспалительных клеток в пограничную зону инфаркта через 24 часа после инфаркта.Анализ срезов сердца выявил значительно сниженную миграцию клеток у мышей, получавших FIPI, по сравнению с контролем, что наблюдалось при окрашивании гематоксилином / эозином (рисунок). Изменения в миграции лейкоцитарных клеток включали нейтрофилы (рисунок) и моноциты (рисунок), как уже наблюдалось у мышей с дефицитом PLD1 (Schonberger et al., 2014), где миграция этих клеток через 24 часа после инфаркта миокарда также была уменьшена. Однако образование конъюгатов тромбоцитов-лейкоцитов (рисунок) и конъюгатов тромбоцитов-нейтрофилов (рисунок) не изменилось у мышей, получавших FIPI, по сравнению с контрольными мышами, что позволяет предположить, что опосредованные тромбоцитами эффекты на лейкоциты не ответственны за изменение миграции лейкоцитов после инфаркта миокарда.Никаких различий в образовании агрегатов тромбоцитов-иммунных клеток не наблюдалось у мышей с двойным дефицитом PLD1 / PLD2 (дополнительный рисунок S1). Более того, мы обнаружили сопоставимые уровни IL-1β в плазме мышей, получавших FIPI, по сравнению с контролем (рисунок). В соответствии с этим результатом экспрессия IL-6 в левом желудочке мышей через 24 часа после ИМ не изменилась (рисунок), что позволяет предположить, что ферментативная активность PLD не влияет на экспрессию цитокинов в острой фазе и высвобождение после ИМ. Однако экспрессия IL-1β в левом желудочке мышей с двойным дефицитом PLD1 / PLD2 также не изменилась (рисунок).

Фармакологическое ингибирование ферментативной активности PLD снижает воспалительную реакцию у мышей через 24 часа после инфаркта миокарда. Через 24 часа после инфаркта миокарда срезы сердца мышей, получавших FIPI (3 мг / кг массы тела в 4% ДМСО / PBS), по сравнению с контрольными окрашивались либо гематоксилином / эозином (A) , либо иммунными клетками-специфическими антителами к нейтрофилам ( B) и макрофаги (C) для анализа миграции воспалительных клеток в пограничную зону инфаркта (n = 5). P <0.05, ∗∗ P <0,01, ∗∗∗ P <0,001. (D, E) Проточно-цитометрический анализ формирования агрегатов тромбоцитарных иммунных клеток через 0, 24 и 72 часа после инфаркта миокарда у мышей, получавших FIPI, по сравнению с контрольными; Тромбоциты - образование агрегатов лейкоцитов слева, тромбоциты - нейтрофилы - образование агрегатов справа ( n = 5–21). (F) Количественный анализ IL-1β в плазме мышей, получавших FIPI, по сравнению с контролем через 24 часа после ИМ (контроль n = 14; FIPI n = 16). (G) Анализ экспрессии IL-1β в левом желудочке Pld1 + / + / Pld2 + / + vs. Pld1 - / - / Pld2 - / - мышей через 24 часа после ИМ с использованием количественной ОТ-ПЦР ( Pld1 + / + / Pld2 + / + n = 3, Pld1 - / - / Pld2 - / - n = 4). (H) Количественный анализ экспрессии IL-6 в левом желудочке мышей, получавших FIPI, по сравнению с контрольными мышами через 24 часа после ИМ (контроль n = 5; FIPI n = 6). Шкала: 50 мкм, увеличение: 400 ×.

Ферментативная активность PLD не влияет на выживаемость клеток через 24 часа после MI

Апоптоз играет роль в процессе повреждения тканей после инфаркта миокарда.Чтобы исследовать, влияет ли фармакологическое ингибирование PLD на апоптоз клеток после I / R, мы определили экспрессию различных анти- и проапоптотических маркеров в левом желудочке мышей через 24 часа после инфаркта миокарда с использованием количественной RT-PCR. Как показано на фигуре, уровень экспрессии регулятора апоптоза Bcl-2-ассоциированного X-белка (Bax) и антиапоптотических маркеров Bcl-xL и Bcl-2 не изменился у мышей, получавших FIPI, по сравнению с контрольными (фигура). Соответственно, мы не обнаружили различий между обработанными FIPI и контрольными мышами, когда мы определили количество положительных по каспазе-3 клеток в зоне инфаркта через 24 часа после инфаркта миокарда (рисунок).Затем мы провели еще один эксперимент для подтверждения результатов гистологии и проанализировали положительные по каспазе-3 клетки in vitro с использованием клеток HL-1, которые были подвергнуты 2-часовой ишемии и 5-часовой реперфузии с различными дозами (1 или 10 мкМ) или без них. ФИПИ. FIPI добавляли к соответствующим клеткам сразу после периода ишемии во время реперфузии, клетки лизировали и определяли уровень экспрессии каспазы-3 с помощью вестерн-блоттинга. Значительное увеличение количества каспазы-3 было обнаружено после I / R во всех образцах по сравнению с контролями без ишемии.Однако не было различий между контролями DMSO и клетками, обработанными FIPI, при всех концентрациях, протестированных в этом анализе (рисунок).

Обработка FIPI не выявила изменений в апоптозе клеток после I / R. (A) Анализ количественной ОТ-ПЦР не показывает различий в экспрессии маркеров клеточного апоптоза Bax, Bcl-xl и Bcl -2 в левом желудочке (LV) мышей, получавших FIPI (3 мг / кг массы тела в 4% ДМСО / PBS) по сравнению с контрольными мышами через 24 часа после ИМ (контроль n = 5, FIPI n = 6). (B) Количество положительных по каспазе-3 клеток в пограничной зоне инфаркта не отличается у мышей, получавших FIPI, и контрольных мышей через 21 день после инфаркта миокарда (контроль n = 4, FIPI n = 5) (C ) После I / R in vitro количество активированной каспазы 3 в клетках HL-1 не изменяется после обработки FIPI ( n = 4). P <0,05, ∗∗ P <0,01, ∗∗∗ P <0,001.

Лечение FIPI не влияет на образование рубцов и сердечную функцию через 21 день после MI

Для исследования последствий снижения миграции воспалительных клеток в пограничную зону инфаркта через 24 часа после инфаркта миокарда у мышей, получавших FIPI, мы затем проанализировали повреждение сердца и ремонт 21 день пост МИ.Определение размера инфаркта и сердечной функции по фракции выброса, сердечному выбросу и фракционному укорочению не отличалось у мышей, получавших FIPI, по сравнению с контрольной группой (рисунки). Дополнительные гемодинамические параметры через 24 часа и 21 день после инфаркта миокарда были измерены с помощью эхокардиографии и представлены в таблице, показывающей отсутствие различий между мышами, получавшими FIPI и DMSO.

Лечение FIPI не влияет на формирование рубцов через 21 день после ИМ. (A) Нет изменений в размере инфаркта ( n = 6) и (B) функции левого желудочка через 21 день после инфаркта миокарда у мышей, получавших FIPI (3 мг / кг массы тела в 4% DMSO / PBS), по сравнению сконтроли ( n = 14–18). (C) Окрашивание удаленного миокарда сириусовым красным не показывает различий в количестве интерстициального коллагена между мышами, получавшими FIPI, и контрольной группой (контроль n = 9, FIPI n = 6) (D) Количественная оценка Положительные по α-SMA миофибробласты в пограничной зоне инфаркта сердца через 21 день после инфаркта миокарда у мышей, получавших FIPI, по сравнению с контрольными мышами не показали изменений между группами. Показаны репрезентативные изображения (контроль n = 9, FIPI n = 6).Шкала: 50 мкм, увеличение: 400 ×.

Таблица 1

Гемодинамические измерения после ИМ.

9049AY 900 41

Карим М.Р., Эндо К., Мур А.В. и Танигучи Х. (2014). Всего

монтируют иммуномечение нейронов обонятельных рецепторов в антенне

дрозофилы.Журнал визуализированных экспериментов, 87, e51245.

DOI: 10.3791 / 51245

Kazamam, H., & Wilson, R.I. (2008). Гомеостатическое соответствие и линейное усиление не

в идентифицированных центральных синапсах. Нейрон, 58,

401–413. doi: 10.1016 / j.neuron.2008.02.030

Келеман, К., Вронту, Э., Kr €

Уттнер, С., Ю, Дж.Й., Куртович-Козарич, А.,

и Диксон, Б.Дж. ( 2012). Дофаминовые нейроны модулируют феромон

ответов при обучении ухаживанию у дрозофилы.Природа, 489, 145–149.

doi: 10.1038 / nature11345

Китамото Т., Ван В. и Сальватерра П.М. (1998). Структура и

организация холинергического локуса Drosophila. Биологический журнал

Химия, 273, 2706–2713. DOI: 10.1074 / jbc.273.5.2706

Кохатсу С., Коганедзава М. и Ямамото Д. (2011). Контакт с самками

активирует специфичные для самцов интернейроны, которые запускают стереотипное поведение ухаживания

у Drosophila.Neuron, 69, 498–508.DOI: 10.1016 /

j.neuron.2010.12.017

Куртович А., Видмер А. и Диксон Б.Дж. (2007). Один класс из

обонятельных нейронов опосредует поведенческие реакции на половой феромон Drosophila

. Природа, 446, 542–546. DOI: 10.1038 / nature05672

Лэндис, Г.Н., Боле, Д., Лу, Л. и Тауэр, Дж. (2001). Высокочастотная генерация

условных мутаций, влияющих на развитие и продолжительность жизни Drosophila melanogaster

. Генетика, 158, 1167–1176.

Лу Т.З. и Фенг З.-П. (2012). NALCN: Регулятор активности кардиостимулятора

. Молекулярная нейробиология, 45, 415–423. doi: 10.1007 / s12035-

012-8260-2

НЕЙРОГЕНЕТИЧЕСКИЙ ЖУРНАЛ 11

Загружено [Российская академия наук] в 01:18 01 декабря 2017

Все темы для эссе из FIPI

Виртуальное Интернет-общение приводит к потере реальных социальных навыков. Обучение в Интернете интереснее, чем учеба в школе., В любой профессии дисциплина важнее таланта. Летние каникулы в деревне лучше всего подходят для подростков. Публичные библиотеки становятся менее популярными и скоро исчезнут., Человек, свободно владеющий иностранным языком, может легко работать в качестве переводчик., Человек, свободно владеющий иностранным языком, легко может этому научить., Одноклассники - лучшие друзья., Легче заводить друзей, чем содержать их., Молодые люди больше любят путешествовать, чем пенсионеры., Шитье или вязать одежда дома сегодня - пустая трата времени и денег., Старшеклассникам важно изучать обязательные предметы, даже если они не видят в них необходимости в ближайшем будущем., Цирк - лучшее развлечение для детей., Детство - самый безопасный период в жизни человека., Интернет является величайшим расточителем времени., Пункты быстрого питания должны быть закрыты., Неправильно быть строгим с маленькими детьми., Правительство несет ответственность за охрану окружающей среды., В каждом городе и в каждом городе должен быть зоопарк., Интернет - самое большое зло нашего времени., Лучшее время, проведенное с семьей и друзьями., Нет мужских или женских профессий., В жизни в большом городе недостатков больше, чем преимуществ., Все хотели бы работать из дома., Лучшие праздники и фестивали. имеют особые традиции празднования., Ученик не может эффективно учиться без компьютера., Дистанционное обучение - лучшая форма обучения., Исследование космоса было величайшим достижением 20-го века. Одежда, которую носят люди, может влиять на их поведение., Компьютеры не могут заменить людей., Экзамены мотивируют студентов учиться усерднее., Спорт объединяет людей., Заниматься спортом лучше, чем смотреть, как это делают другие. Спорт помогает людям бороться со стрессом. , Неправильно заставлять учеников много читать летом., Перед осмотром достопримечательностей следует почитать об исторических местах., Ранний выбор карьеры - ключ к успеху., Наука - это первое, что нужно финансировать в современном мире. ., Цифровая грамотность - залог успеха в любом деле., Дружба - величайший дар жизни., Покажи мне свою комнату, и я скажу, кто ты. Некоторые думают, что экстремальные виды спорта помогают укрепить характер. Некоторые думают, что для получения хорошего образования нужно уехать за границу., Некоторые думают, что можно только один верный друг., Некоторые думают, что изучение иностранных языков - пустая трата времени и денег., Некоторые думают, что молодые люди должны идти по стопам родителей при выборе профессии. в вашей стране - лучший способ узнать об этом., В настоящее время естественные науки важнее гуманитарных. Компьютер не может заменить учителя., Образование - самое ценное для подростка. ., Легко жить без Интернета., Университетское образование необходимо молодым людям., В Интернете невозможно найти настоящих друзей., Волонтерство необходимо для подростков., С Интернетом нам больше не нужно телевидение.

сотрудников Вьетнамского агентства посещают инвентаризацию и анализ лесов - CompassLive

Представители лесных ведомств Вьетнама с директором программы Биллом Буркманом (крайний справа) в офисе FIA в Ноксвилле, штат Теннесси.Фото Лесной службы США.

Десять официальных лиц из Управления лесов Вьетнама (VNFOREST ), Департамента защиты леса и Института инвентаризации и планирования лесов (FIPI) посетили Южную исследовательскую станцию ​​Лесной службы США (SRS) Инвентаризация и анализ лесов (FIA) ) подразделение в Ноксвилле, штат Теннесси, и офисы лесной службы в Вашингтоне, округ Колумбия, в течение недели с 29 апреля по 5 мая.

Группа находилась в ознакомительной поездке по укреплению национального управления инвентаризацией лесов, спонсируемой SilvaCarbon , флагманской программой, поддерживающей U.S. Стратегия правительства для быстрого старта финансирования для стран, участвующих в программе Организации Объединенных Наций по сокращению выбросов в результате обезлесения и деградации лесов и увеличения запасов углерода в лесах ( REDD + ) в развивающихся странах.

Должностные лица из Вьетнама хотели:

  • Понимать, как потребности в информации об управлении ресурсами используются для разработки национальной инвентаризации лесов США, сбора данных, обработки информации и распространения результатов;
  • Посмотрите, как данные проходят через системы инвентаризации лесов и многочисленные петли обратной связи, которые обеспечивают контроль и контроль качества данных;
  • Узнайте о законодательных основах, механизмах финансирования и административной организации U.S. национальная инвентаризация лесов; и
  • Обсудите, как собранная информация распространяется среди заинтересованных сторон и как добавляется стоимость с помощью этих разнообразных продуктов и торговых точек.

Группа встретилась с менеджером программы FIA Биллом Буркманом и его подразделением в Ноксвилле, чтобы ознакомиться с организацией SRS FIA и узнать о программе «Выпуск лесной продукции» (TPO) и исследованиях использования древесины, доступ к общедоступным данным через -строчная отчетность по инвентаризации лесов, партнерства и то, как внешние заинтересованные стороны используют данные FIA.Поездка также включала посещение дендрария Университета Теннесси в Ок-Ридже для демонстрации полевых участков и ознакомления с планами участков. Они также узнали о предполевых мероприятиях, особенностях участка и собственности, о том, как собираются данные и как осуществляется контроль качества и качества.

Ознакомительная поездка завершилась в Вашингтоне, округ Колумбия, подписанием письма о намерениях между Лесной службой и VNFOREST о сотрудничестве по вопросам лесного хозяйства. Лесная служба Начальник Томас Тидвелл подписал письмо о намерениях с заместителем генерального директора VNFOREST г-ном.Во Дай Хай . Сферы сотрудничества включают управление пожарами, предотвращение и контроль; REDD + и стратегии развития с низким уровнем выбросов; борьба с незаконными лесозаготовками, охотой на диких животных и связанной с ними торговлей; охрана водоразделов и прибрежных районов для экосистемных услуг; и наращивание потенциала на всех уровнях для улучшения полевых операций.

Для получения дополнительной информации отправьте электронное письмо Тому Брандейсу по адресу [email protected]

Получите доступ к последним публикациям ученых SRS .

IJMS | Бесплатный полнотекстовый | Усиленная интегриновая активация тромбоцитов с дефицитом PLD2 ускоряет воспаление после инфаркта миокарда

1.Введение

Фосфолипаза (PL) D1 и PLD2 принадлежат к семейству фосфолипаз, которые катализируют разложение фосфатидилхолина на фосфатидную кислоту (PA) и холин. Как вторичный посредник, PA играет очень важную роль во многих клеточных процессах, таких как клеточная адгезия, миграция клеток и выживание клеток [1,2]. Две изоформы имеют 50% гомологичную последовательность [3] и экспрессируются в лейкоцитах и ​​тромбоцитах, где они важны для опосредованной интегрином клеточной адгезии [4]. Активность PLD можно регулировать по-разному.PLD1 проявляет очень низкую базальную активность и активируется членами семейства Rho, такими как RhoA, Rac1 и протеинкиназа C (PKC). Напротив, PLD2 проявляет высокую базальную активность, но потенциал активации, индуцированный различными активаторами, очень низкий [2]. В тромбоцитах PLD1 играет важную роль в опосредованной гликопротеином (GP) Ib активации интегрина и клеточной адгезии, а также в генетической делеции. PLD1 защищает мышей от артериального тромбоза и ишемически-зависимых заболеваний, таких как ишемический инфаркт головного мозга [4].В воспалительных условиях PLD1 поддерживает активацию интегрина IIb β 3 и прочную адгезию тромбоцитов и иммунных клеток к поврежденному эндотелию. Потеря PLD2 не изменяет активацию интегрина у здоровых мышей, хотя активность PLD в тромбоцитах снижается в отсутствие PLD2 [5]. У мышей, лишенных обеих изоформ, дефекты активации интегрина и дегрануляции защищали этих мышей от артериального тромбоза [6] и ишемического инсульта [7]. Такие же результаты были получены при лечении тромбоцитов и мышей ингибитором PLD FIPI (5-фтор-2-индолил десхлорогалопемид), который блокирует ферментативную активность обеих изоформ PLD [7].После сердечной ишемии и реперфузионного (I / R) повреждения потеря PLD1 привела к увеличению размера инфаркта и нарушению функции левого желудочка через 28 дней после инфаркта миокарда (MI) по сравнению с контрольными мышами. Было показано, что снижение TNF-α-опосредованного воспаления в острой фазе после I / R и измененное TGF-β-опосредованное образование коллагеновых рубцов ответственны за снижение сердечной функции [8]. Фармакологическое ингибирование PLD показало, что ферментативная активность PLD не влияла на передачу сигналов TNF-α и заживление после ИМ у мышей [9].Однако ничего не известно о влиянии PLD2 на регуляцию TNF-α и заживление миокарда после I / R у мышей.

В этом исследовании мы смогли показать, что PLD-опосредованная регуляция TNF-α ограничена PLD1, поскольку потеря PLD2 не препятствовала передаче сигналов TNF-α, размеру инфаркта или сердечной функции после iI / R. Однако дефицит PLD2 привел к усилению активации интегрина тромбоцитов в очень острой фазе после ИМ. Измененная активация интегрина индуцировала повышенное высвобождение IL-6 из эндотелиальных клеток in vitro и повышенные уровни IL-6 в плазме после инфаркта миокарда in vivo.Это сопровождалось усилением воспалительной реакции, включая повышенную миграцию воспалительных клеток в зону инфаркта левого желудочка через 24 часа после I / R.

3. Обсуждение

Настоящее исследование показало, что PLD2 регулирует воспаление за счет индуцированного тромбоцитами повышения высвобождения IL-6 из эндотелиальных клеток в острой фазе после I / R миокарда. Усиление воспаления привело к усилению миграции воспалительных клеток в пограничную зону инфаркта в левом желудочке.Однако измененные воспалительные реакции мышей с дефицитом PLD2 не вызывали различий в размере инфаркта, повреждении сердца, формировании рубца или функции левого желудочка через 24 часа и 21 день после инфаркта миокарда. Кроме того, PLD2 не изменяет экспрессию и высвобождение TNF-α, как недавно было показано для PLD1 [8]. Активность PLD усиливается в сердцах после I / R [15] и, как сообщается, участвует в процессах ишемического прекондиционирования в сердцах кроликов [ 16]. Повышенные уровни белка PLD1 были обнаружены в удаленном миокарде после инфаркта миокарда, но не в рубце, который показывает экспрессию белка PLD2 [17].Более того, образование PA за счет ферментативной активности PLD важно для функции сердца из-за его способности увеличивать внутриклеточную концентрацию свободного Ca 2+ в кардиомиоцитах взрослых для увеличения сердечной сократительной активности нормального сердца. Кроме того, PA считается важным преобразователем сигналов при гипертрофии сердца [18]. В последние годы мы предоставили доказательства того, что PLD1 модулирует воспаление и образование рубцов, включая регуляцию экспрессии и высвобождения TNF-α, что приводит к увеличению размера инфаркта, снижению качества рубцовой ткани и снижению сердечной функции через 28 дней после инфаркта миокарда [8].Использование ингибитора PLD FIPI, который блокирует ферментативную активность обеих изоформ PLD1 и PLD2, показало, что PLD1-опосредованная регуляция TNF-α, сердечной функции и образования рубцов зависит от неферментативных свойств PLD, в то время как миграция воспалительных клеток в Пограничная зона инфаркта после ИМ зависит от липазной активности PLD. Это было связано с уменьшением инфильтрации лейкоцитов в поврежденную сердечную ткань как у мышей с дефицитом PLD1, так и у мышей, получавших FIPI. Однако только дефицит PLD1 привел к снижению передачи сигналов TNF-α и усилению сердечного повреждения, поскольку лечение мышей FIPI не изменило размер инфаркта или функцию сердца по сравнению с контрольными мышами, не получавшими лечения [9].В отличие от мышей с дефицитом PLD1, потеря PLD2 приводила к усилению воспалительной реакции через 24 часа после инфаркта миокарда. Различные отчеты в прошлом предполагали важную роль PLD2 в воспалении. В отличие от исследования Сперанца и его коллег, которые показали, что подавление PLD2 подавляет способность клеток подвергаться хемотаксису, более недавняя публикация предоставила доказательства увеличения рекрутирования нейтрофилов и макрофагов у мышей с дефицитом PLD2 и нокдауна экспрессии гена Pld2 в остром периоде. повреждение легких [19,20].Таким образом, могут играть роль различные экспериментальные подходы или сценарии воспалительного процесса. Также возможно, что тип воспаления (острый или хронический) играет роль в PLD2-опосредованной миграции лейкоцитов или поврежденных органов, таких как легкие или сердце.Увеличение воспаления не привело к изменению размера инфаркта, образованию рубцов или сердечной функции. в ранние (24 часа) или поздние (21 день) моменты времени. Это согласуется с различными наблюдениями, демонстрирующими, что измененное воспаление, ремоделирование матрикса и формирование коллагеновой сети левого желудочка вносят вклад в дисфункцию левого желудочка [21].Таким образом, неудивительно, что усиленное воспаление у мышей с дефицитом PLD2 не привело к изменению размера инфаркта или функции сердца. Этот вывод подтверждается анализом мышей с дефицитом PLD1, у которых развиваются измененные сердечные повреждения и функции в результате различий в воспалительной реакции и ремоделировании сердца по сравнению с контрольными мышами [8]. Наши результаты свидетельствуют о том, что PLD2 является негативным регулятором воспаления. после MI. Уже было показано, что PLD2 отрицательно регулирует кровяное давление посредством ингибирования пути передачи сигнала эндотелиальной синтазы оксида азота (eNOS) [22].У животных с сепсисом потеря PLD2 сопровождается повышенной бактерицидной активностью и привлечением нейтрофилов в легкие [23]. Первые доказательства того, что PLD2 является негативным регулятором функции тромбоцитов, было показано на мышах с дефицитом PLD1, которым вводили ингибитор PLD FIPI [24]. Однако тромбоциты с дефицитом PLD2 от здоровых мышей не обнаруживают каких-либо изменений, что позволяет предположить, что эти различия являются результатом неферментативных и ферментативных свойств изоформ PLD. Здесь мы приводим прямые доказательства того, что тромбоциты мышей, перенесших инфаркт миокарда, имеют другой профиль активации, чем тромбоциты здоровых мышей (рис. 2).В то время как тромбоциты с дефицитом PLD2 от здоровых мышей-доноров не показывают значительных различий в активации интегрина или воздействии P-селектина после стимуляции различными агонистами, повышенная активация тромбоцитов в ответ на активацию рецептора, связанного с G-белком, наблюдалась у тромбоцитов с дефицитом PLD2 по сравнению с контролем. тромбоциты через 4 ч после ИМ. Эти результаты предполагают, что ИМ вызывает измененные реакции тромбоцитов, которые могут быть обнаружены в кровообращении мышей. Ингибирование тромбоцитов аспирином и ингибиторами P2Y 12 необходимо у пациентов с острым инфарктом миокарда.Помимо своей роли в тромбозе, тромбоциты, как известно, модулируют воспаление, выживание клеток и восстановление органов, но их роль после инфаркта миокарда четко не определена. Недавние публикации предполагают, что тромбоциты играют роль в острой фазе после инфаркта миокарда, поскольку антитромбоцитарные вмешательства подавляют рекрутирование воспалительных клеток в инфаркт миокарда [25]. Блокада основного рецептора коллагена тромбоцитов GPVI уменьшала размер инфаркта через 24 ч после ИМ [26]. Кроме того, GPVI участвует в адгезии тромбоцитов к активированному эндотелию, экспрессии воспалительных цитокинов и функции миокарда после инфаркта миокарда [27,28,29].В этом исследовании мы представляем первое доказательство того, что уровни IL-6 в плазме регулируются, по крайней мере частично, тромбоцитами-опосредованной активацией эндотелиальных клеток после инфаркта миокарда. Однако наши данные не показали каких-либо прямых эффектов тромбоцитов с дефицитом PLD2 на лейкоциты, поскольку количество конъюгатов тромбоцитов и лейкоцитов и уровни воспалительных цитокинов, таких как IL-1β и TNF-α, не изменились. Таким образом, усиление миграции воспалительных клеток может быть связано с измененным ИЛ-6 эндотелиального происхождения. Однако мы не можем исключить, что разные клетки и механизмы объясняют увеличение IL-6 в плазме мышей с дефицитом PLD2.Тем не менее, наши данные in vitro ясно показали, что повышенные уровни IL-6 в плазме могут быть, по крайней мере частично, связаны с взаимодействиями тромбоцитов и эндотелиальных клеток, которые модулируются PLD2, полученным из тромбоцитов. У мышей с дефицитом PLD2 уровни TGF-β в плазме. были уменьшены в первые моменты времени после ИМ, но нормализовались через 21 день по сравнению с контрольными мышами (Рисунок 1F и Рисунок 6G). Считается, что тромбоциты могут быть основным источником TGF-β на ранней стадии заживления инфаркта [14]. Таким образом, снижение уровня TGF-β в плазме через 72 часа может быть связано с измененной активацией тромбоцитов у мышей с дефицитом PLD2, перенесших экспериментальный ИМ.Это снижение TGF-β может объяснить усиление воспаления в острой фазе после инфаркта миокарда у мышей с дефицитом PLD2, поскольку TGF-β регулирует функцию воспалительных лейкоцитов, ингибируя экспрессию провоспалительных генов макрофагов. Напротив, макрофаги и фибробласты могут нести ответственность за устойчивую активацию TGF-β во время фазы пролиферации, способствуя конверсии миофибробластов и синтезу внеклеточного матрикса при заживлении инфарктов [14,30]. В эти более поздние моменты времени не наблюдалось различий в уровнях TGF-β в плазме, что позволяет предположить, что снижение TGF-β в ранние моменты времени является результатом измененной активации тромбоцитов у мышей с дефицитом PLD2.

В совокупности это исследование добавляет новую информацию о влиянии измененной активации тромбоцитов на воспаление и раскрывает влияние PLD2 на воспаление и заживление миокарда после инфаркта миокарда, чтобы дополнить наше понимание роли изоформ PLD в процессе повреждения сердца.

4. Материалы и методы

4.1. Животные
Исследования на животных проводились в соответствии с директивами Европейского парламента по использованию живых животных в научных исследованиях и в соответствии с немецким законодательством о защите животных.Протокол был одобрен Комитетом по уходу за животными Университета Генриха Гейне и администрацией округа Северный Рейн-Вестфалия (LANUV; NRW; номер разрешения 84-02.04.2015.A558, период 2016–2021 гг.). Мыши, нацеленные на ген, лишенные PLD2 (Pld2 - / - ), были описаны ранее [31]. Соответствующие однопометники дикого типа были выведены из родительских пар и генотипированы с помощью ПЦР. Мышей анестезировали кетамином (Ketaset, Zoetis, Берлин, Германия, 100 мг / мл) и ксилазином (Wirtschaftsgenossenschaft deutscher Tierärzte eG (WDT), Garbsen, Германия, 20 мг / мл) внутрибрюшинно (т.е.п.) укол перед операцией. Эвтаназия проводилась путем смещения шейного отдела.
4.2. Ишемия миокарда и реперфузия у мышей

Для анализа инфаркта миокарда самцов мышей в возрасте от 10 до 12 недель анестезировали внутрибрюшинной инъекцией раствора с кетамином (90 мг / кг массы тела) и ксилазином (10 мг / кг массы тела). масса). ИМ индуцировали перевязкой левой передней нисходящей артерии (ПНА) на 60 мин. Затем, через 24 часа после реперфузии, определяли ишемическую область (область риска) и область инфаркта (размер инфаркта) путем окрашивания раствором TTC / Evans Blue.Соотношения различных площадей были количественно определены в цифровом виде с помощью видеопланиметрии. Для анализа размера инфаркта в хронической серии размер инфаркта определяли с помощью одноэтапного окрашивания трихромом по Гомори через 3 недели после реперфузии. После успешного прохождения анестезии сердца удаляли, фиксировали в 4% формалине, заливали парафином и делали серийные срезы для окрашивания одноэтапным раствором трихома Гомори. Размер инфаркта выражали как процент от общей площади левого желудочка (ЛЖ).Кроме того, эхокардиография выполнялась в разные моменты времени с использованием ультразвукового аппарата Vevo 2100 (VisualSonics Inc., Ботелл, Вашингтон, США) и различных параметров, например фракции выброса (%), сердечного выброса (мл / мин), фракционного укорочения (%). и ударный объем (мкл) определяли с помощью соответствующего программного обеспечения.

4.3. Коллагеновое окрашивание срезов сердца

Всего через 21 день после взятия ишемии / реперфузии сердца их заливали парафином и готовили срезы этих сердец.Образование рубцов анализировали путем окрашивания этих срезов раствором Гомори, Буэна (Sigma, Дармштадт, Германия) и раствором гематоксилина (Carl Roth, Карлсруэ, Германия). Изображения получали с помощью бинокулярного микроскопа (Nikon SMZ25, Токио, Япония), оценивали с помощью программного обеспечения Zen2 blue edition (Zeiss, Оберкохен, Германия) и определяли отношение размера инфаркта к общей площади левого желудочка. Для определения количества интерстициального коллагена срезы сердца окрашивали красителем Пикросириус красным (Morphisto, Франкфурт-на-Майне, Германия), а раствор Целестина синим (Sigma, Дармштадт, Германия) использовали для окрашивания ядер.Интерстициальный коллаген измеряли в процентах от доли площади. Кроме того, плотность коллагена анализировали с помощью микроскопии в поляризованном свете и оценивали с помощью программного обеспечения Image J.

4.4. Иммуногистохимия срезов сердца

Через 24 часа после кардиального I / R у мышей брали сердца и парафиновые срезы этих сердец окрашивали раствором гематоксилин / эозин (HE) (Carl Roth). Общее количество клеток, мигрировавших в инфарктную область сердца, было подсчитано для каждого поля зрения, и данные представлены для 10 3 / мм 2 .

Для анализа клеток, экспрессирующих PLD1 или PLD2 в левом желудочке, окрашивание стрептавидин-биотин-иммунопероксидазой срезов сердца залитых парафином сердец до и через 24 часа после ишемии / реперфузии проводили с использованием кроличьих антител против PLD1 мыши ( Cell Signaling, Danvers, Массачусетс, США) и кроличьих антител против PLD2 мыши (Acris, Rockville, MD, США) с использованием второго набора антител, меченных пероксидазой хрена (HRP) (LSAB2 System-HRP; DAKO, Санта-Клара, Калифорния, США) и реагент диаминобензидин (DAB) (DAKO) в качестве хромогена.Подсчитывали положительные клетки, и данные представляли для каждого поля зрения.

4.5. Иммуноферментный анализ (ELISA)

Для количественного определения IL-1β, IL-6, TNF-α и TGF-β в плазме через 24 часа после ишемии / реперфузии гепаринизированную кровь центрифугировали 10 минут при 650 g. Отбирали плазму и измеряли количество цитокинов с помощью иммуноферментного анализа (ELISA) в соответствии с протоколом производителя (DuoSet Mouse IL-1β / IL-1F2 / DuoSet Mouse IL-6 / DuoSet Mouse TNF-α, R&D Systems, Миннеаполис , Миннесота, США).TGF-β в плазме мышей Pld2 + / + и Pld2 - / - количественно определяли через 72 часа и 21 день после I / R (DuoSet Mouse TGF-β, R&D Systems).

Для анализа тех же уровней цитокинов в супернатанте моноцитов выделяли моноциты, стимулировали липополисахаридом (LPS) 10 мг / мкл и супернатант отбирали через 0, 6, 12 и 24 часа после стимуляции. Моноциты мышей были свежевыделены из цельной крови мышей Pld2 + / + и Pld2 - / - . 400 мл цельной крови центрифугировали 20 мин при комнатной температуре.Лимфоциты разделяли с использованием разделяющего раствора Biocoll (Biochrom) с центрифугированием в течение дополнительных 10 мин. За лизисом эритроцитов следовало мечение клеток с использованием 10 мл микрошариков CD11b (Miltenyi Biotec, Bergisch Gladbach, Германия) на 10 7 клеток. Моноциты разделяли с помощью сепаратора Vario Macs (Miltenyi Biotec).

Чтобы исследовать высвобождение цитокинов эндотелиевыми клетками, уровни IL-6 измеряли в супернатанте либо через агонисты (100 нг / мл TNF-α, 10 мкМ АДФ (Sigma, Дармштадт, Германия), 3 мкМ U46619 (Tocris, Bristol). , Великобритания), 0.005 и 0,02 Ед / мл тромбина) стимулировали клетки MHEC5-T или после совместной инкубации с тромбоцитами, предварительно активированными теми же агонистами через 3,5 часа. Поскольку использовался весь препарат тромбоцитов, проводили контрольные эксперименты для исключения эндотелиальных клеток, секретирующих IL-6 в ответ на агонисты тромбоцитов ADP / U46619 или только тромбин. Клетки MHEC5-T совместно инкубировали с ADP / U46619 или тромбином в отсутствие тромбоцитов, чтобы получить доказательства того, что эти агонисты тромбоцитов не способны индуцировать высвобождение IL-6 из эндотелиальных клеток как таковых.

Все твердофазные иммуноферментные анализы проводили в соответствии с протоколом производителя.

4.6. Проточный цитометрический анализ формирования агрегатов тромбоцитов-иммунных клеток, нейтрофилов и активации тромбоцитов

До и через 24 и 72 ч после I / R образование агрегатов тромбоцит-иммунных клеток измеряли с помощью проточной цитометрии на основе флуоресценции. Гепаринизированная кровь мышей Pld2 + / + и Pld2 - / - до и после I / R дважды промывалась буфером Тирода, центрифугировалась 5 мин при 650 × g, супернатант удалялся, и только богатый клетками осадок был используется для измерений.Образцы инкубировали с конъюгированными антителами к тромбоцитам (GPIb-PE, Emfret, Eibelstadt, Германия) и нейтрофилам (Ly6G-APC, Biolegend, Сан-Диего, Калифорния, США) или лейкоцитам (CD45-APC, BD Bioscience, Гейдельберг, Германия). и определяли MFI (среднюю интенсивность флуоресценции).

Для определения активации нейтрофилов до и через 24 часа после I / R гепаринизированную кровь мышей Pld2 + / + и Pld2 - / - дважды промывали буфером Тирода путем центрифугирования в течение 5 минут при 650 × g.Осадок инкубировали с антителом Ly-6G Dylight 488 (BD) и APC-CD11b (MAC-1) в течение 15 мин при комнатной температуре. MFI представляет воздействие активированных нейтрофилов MAC-1.

Для измерения активации тромбоцитов гепаринизированную кровь мышей Pld2 + / + и Pld2 - / - через 0, 4, 24 часа и 21 день после I / R промывали буфером Тирода и центрифугировали в течение 5 минут при 650 g. супернатант удаляли и осадок разбавляли буфером Тироде для измерений. Образцы инкубировали с FITC-конъюгированным антителом против P-селектина (Emfret), PE-конъюгированным антителом против интегрина α IIb β 3 (Emfret) и классическими агонистами для активации тромбоцитов, такими как ADP, U46619, CRP (Кембриджский университет , Великобритания) или тромбин (Roche) в течение 7 мин при 37 ° C и 7 мин при комнатной температуре.Активацию интегрина и экспозицию Р-селектина определяли с помощью проточной цитометрии на основе флуоресценции.

4.7. Количественная ПЦР в реальном времени

Для анализа эндогенно экспрессируемых уровней Pld2, TNF-α, IL-1β, Bax и Bcl-xL только выделенная общая РНК левого желудочка сердца через 24 часа после ишемии Pld2 + Использовали мышей / + и Pld2 - / - . Выделение РНК выполняли с помощью системы ReliaPrep RNA Tissue Miniprep (Promega, Mannheim, Германия) в соответствии с протоколом производителя.Количественную ПЦР в реальном времени проводили с использованием смеси Fast Sybr Green Master Mix (Thermo Fischer Scientific) в соответствии с протоколом производителя. Уровень экспрессии мишени был нормализован к уровням экспрессии РНК глицеральдегид-3-фосфатдегидрогеназы (Gapdh) в качестве контроля. После обратной транскрипции была проведена количественная ПЦР-амплификация с использованием следующих олигонуклеотидных праймеров: Pld2 для 5´GAAAGGGATAGGAAAGTCCAGG´3, rev 5´GGGTGGAAAGAGAACCCATAG´3; TNF – α для 5´GCCCCCATCTGACCCC-TTT´3; rev 5´GGGGCTGGCTCTGTGAGGAA´3; IL-1β для 5´AGCTTCCTTGTGCAAGTGTCTGAG´3, rev 5´TGTTGATGTGCTGCTGCGAGAT´3; Bax для 5´TGAAGACAGG GGCCTTTTTG´3; ред.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

n = 3–20 Частота сердечных сокращений (уд / мин) Ударный объем (мкл) Конечный систолический объем (мкл) Конечный диастолический объем (мкл)
BASAL
C57BL / 6J control 469,36 12,22 39,53 1,49 24,69 1,38 64,24 2.07
C57 / Bl / 6J + FIPI 478,72 10,96 37,994 1,14 23,36 1,43 61,36 2,08
24 ч POST MI
Контроль за 24 ч POST MI
27,58 1,28 42,35 2,36 69,96 1,95
C57 / Bl / 6J + FIPI 439,05 22,6 28,35 1,73 45,63 MI 1,92 73,98 1,96
Управление C57BL / 6J 514.25 7,95 28,11 1,46 39,33 3,42 67,44 1,79
C57 / Bl / 6J + FIPI 517,34 17,61 27,199 2,34 48,77 7,12

75497 5,77 отложение коллагена в сердце после инфаркта миокарда. Поэтому мы количественно оценили интерстициальный фиброз в областях, не затронутых инфарктом. Как показано на фигуре, обработка мышей FIPI не изменяла образование интерстициального коллагена, что определялось окрашиванием удаленного миокарда сириусом красным (рисунок).Кроме того, мы иммуноокрашивали сердечные миофибробласты с α-SMA через 21 день после инфаркта миокарда. Обработка мышей FIPI не вызвала изменений в количестве положительных по α-SMA клеток (рисунок).

Ферментативная активность PLD не отвечает за опосредованную PLD регуляцию TNF-α при воспалении

PLD1 имеет решающее значение для TNF-α-опосредованного воспаления после инфаркта миокарда и LPS-индуцированного сепсиса у мышей (Schonberger et al., 2014; Urbahn et al. , 2018). Чтобы выяснить, важна ли ферментативная активность PLD для регуляции TNF-α, мы определили экспрессию TNF-α в левом желудочке мышей, получавших FIPI.Обработка мышей FIPI не приводила к изменениям экспрессии TNF-α по сравнению с контрольными мышами (рисунок). Напротив, экспрессия TNF-α была значительно снижена у мышей с двойным дефицитом PLD1 / PLD2 через 24 часа после инфаркта миокарда, что свидетельствует о том, что ферментативная активность PLD не отвечает за опосредованную PLD регуляцию TNF-α при воспалении (рисунок). Соответственно, анализ MEF, обработанных FIPI, не показал различий в высвобождении TNF-α после стимуляции LPS (рисунок). Напротив, стимуляция LPS MEF с дефицитом PLD1 приводила к значительному снижению высвобождения TNF-α (рисунок).Однако обработка FIPI MEF с дефицитом PLD1 не приводила к дальнейшему снижению количества TNF-α в супернатанте MEF, стимулированных LPS (рисунок).

Передача сигналов TNF-α не зависит от ферментативной активности PLD. (A) Экспрессия TNF-α в левом желудочке инфаркта сердца не показывает изменений у мышей, получавших FIPI (3 мг / кг массы тела в 4% ДМСО / PBS), по сравнению с контрольными мышами через 24 ч после ИМ (контроль n = 5, FIPI n = 6). (B) Экспрессия TNF-α в левом желудочке Pld1 + / + / Pld2 + / + vs. Pld1 - / - / Pld2 - / - мышей через 24 часа после ИМ значительно снизилось у мутантных мышей ( Pld1 + / + / Pld2 + / + n = 3/4; Pld1 - / - / Pld2 - / - n = 3/5). (К) Pld1 + / + -MEF обрабатывали FIPI (1 мкМ в DMSO / PBS, за 30 минут до обработки LPS), стимулировали LPS (1 мкг / мл) в течение различных периодов времени, как указано, и высвобождение TNF-α измеряли с помощью ELISA.Не наблюдали различий в высвобождении TNF-α в MEF, обработанных FIPI, по сравнению с необработанными контролями ( n = 5). (Г) Pld1 - / - - MEF обрабатывали FIPI (1 мкМ в ДМСО / PBS) и стимулировали LPS (1 мкг / мл) в течение 12 часов. Высвобождение TNF-α измеряли с помощью ELISA. Выпуск TNF-α Pld1 - / - -MEF и Pld1 - / - -MEF , обработанных FIPI, был снижен по сравнению с Pld1 + / + - MEF ( n = 5 ).LV = левый желудочек. ∗∗ P <0,01 и ∗∗∗ P <0,001.

Обсуждение

Настоящее исследование показало, что ферментативная активность PLD не требуется для опосредованной PLD регуляции TNF-α при воспалении и формировании рубца после I / R. Следовательно, размер инфаркта и сердечная функция не изменились у мышей, получавших FIPI, как это наблюдалось для мышей с дефицитом PLD1, которые демонстрируют увеличенный размер инфаркта и сниженную фракцию выброса и фракционное укорочение после ишемии миокарда (Schonberger et al., 2014).

Различные исследования в прошлом идентифицировали PLD1 как регулятор экспрессии и высвобождения TNF-α. PLD1 необходим для LPS-индуцированной экспрессии и продукции TNF-α в клетках Raw 264.7 (Oh et al., 2015). В синовиальных фибробластах ревматоидного артрита (RASF) ферменты PLD способствуют индуцированной IL-17 и TNF-α экспрессии провоспалительных генов (Friday and Fox, 2016). Активация PLD в естественных клетках-киллерах модулирует синтез TNF-α через фосфатидную кислоту. Однако здесь мы приводим убедительные доказательства того, что PLD1-индуцированная регуляция TNF-α не зависит от его ферментативной активности, поскольку лечение FIPI не изменяет экспрессию и высвобождение TNF-α у мышей и в MEF.Интересно, что PLD1 опосредует регуляцию TNF-α посредством фосфорилирования MEK1 и ERK, что приводит к снижению экспрессии Egr1 после LPS-индуцированного сепсиса у мышей с дефицитом PLD1 (Urbahn et al., 2018).

Липазонезависимая роль PLD была описана в последние годы. Park et al. (2015) показали, что PLD2 способствует деградации индуцируемого гипоксией фактора (HIF) -1a независимо от активности липазы, регулируя стабильность HIF-1a посредством динамической сборки HIF-1a, пролилгидроксилазы (PHD) 2 и фон Хиппеля-Линдау. (VHL) белок.Таким образом, PLD1-опосредованная регуляция TNF-α может быть результатом PLD1-индуцированного образования и / или стабилизации комплекса фосфорилирования, который делает возможным фосфорилирование MEK и / или ERK, включая взаимодействие белков через домен гомологии плекстрина PLD. Другой возможный механизм того, как PLD1 регулирует TNF-α независимо от его ферментативной активности, может заключаться в модуляции активности киназы, ответственной за фосфорилирование MEK и ERK, как наблюдали Ahn et al. (2003), которые продемонстрировали, что PLD1 значительно увеличивает активность киназы c-Src.

В процессах ИМ генетическое удаление PLD1 привело к дефектной миграции воспалительных клеток в пограничную зону инфаркта, снижению секреции TNFα и TGF-β и экспрессии α-актина гладких мышц сердечного фибробласта, что привело к изменению дифференцировки миофибробластов и интерстициального коллагена отложение у мышей с дефицитом PLD1 (Schonberger et al., 2014). В результате размер инфаркта и сердечная функция были нарушены у мышей с дефицитом PLD1 через 28 дней после инфаркта миокарда, что указывает на то, что PLD1 имеет решающее значение для воспаления и опосредованного TGF-β образования коллагеновых рубцов для увеличения функции LV после ишемии и реперфузии (Schonberger et al., 2014). Однако блокирование ферментативной активности PLD с помощью FIPI не изменяет образование рубцов и функцию LV, но вызывает дефектный воспалительный ответ после ишемии / реперфузии. Таким образом, фенотип, наблюдаемый у мышей с дефицитом PLD1, связан с ферментативными и неферментативными свойствами PLD1 после ишемии миокарда и реперфузионного повреждения.

В отличие от регуляции TNF-α, миграция воспалительных клеток зависит от его липазной активности, поскольку мы обнаружили пониженное количество нейтрофилов и моноцитов в пограничной зоне инфаркта у мышей, получавших FIPI, как уже наблюдалось у мышей с дефицитом PLD1 через 24 ч. после ИМ (рисунок; Schonberger et al., 2014). Удивительно, но Kim et al. (2006) предоставили доказательства того, что PLD1-опосредованная регуляция миграции клеток не зависит от активности липазы. Авторы использовали малую интерферирующую РНК для подавления PLD1 в клетках HeLa. В отличие от недавно опубликованных данных, показывающих отсутствие влияния PLD1 на реорганизацию цитоскелета тромбоцитов (Klier et al., 2017), Kim et al. (2006) обнаружили изменение формирования стрессовых волокон и количества очаговых адгезий в этих клетках, когда PLD1 подавлялся. Более того, сниженный миграционный потенциал может быть восстановлен путем добавления PLD1 дикого типа или липазно-неактивного PLD1 в нокдаун-клетки.Здесь мы показали, что фармакологическое ингибирование PLD снижает миграцию воспалительных клеток, как это наблюдается у мышей с дефицитом PLD1, предполагая, что опосредованная PLD адгезия и миграция этих клеток зависят от ферментативной активности PLD (Schonberger et al., 2014; Urbahn et al., 2018 ). Однако в разных клетках могут быть различия. Более того, миграцию клеток анализировали на мышах после повреждения I / R и LPS-индуцированного сепсиса, показывая снижение миграции воспалительных клеток в обеих моделях мышей. Напротив, Kim et al.(2006) использовали опухолевые клетки (клетки HeLa) и проанализировали миграцию клеток in vitro . Эти различия в типах клеток и в экспериментальной установке могут объяснять разные результаты.

TNF-α вносит вклад в повреждение I / R и ремоделирование после ИМ, а также в кардиопротекцию за счет ишемического кондиционирования, подтверждая амбивалентную роль TNF-α (Kleinbongard et al., 2010). В соответствии с важной ролью TNF-α после инфаркта миокарда, мы не обнаружили изменений образования рубцов или сердечной функции у мышей, получавших FIPI.Это предполагает, что пониженные уровни TNF-α в плазме - по крайней мере частично - ответственны за увеличение размера инфаркта и снижение сердечной функции у мышей с дефицитом PLD1, что демонстрирует значительно сниженные уровни TNF-α в плазме через 24 часа после инфаркта миокарда (Schonberger et al., 2014). ). Однако, поскольку FIPI подавляет ферментативную активность как PLD1, так и PLD2, возникает соблазн предположить, играет ли PLD2 какую-либо роль в формировании рубцов и сердечной функции после повреждения I / R.

Снижение миграции воспалительных клеток, наблюдаемое у мышей с дефицитом PLD1 и у мышей, получавших FIPI, может быть связано с активацией интегрина, индуцированной PLD.Поскольку Стегнер и его коллеги показали, что лечение мышей FIPI приводит к защите от образования окклюзионных тромбов, что наблюдается у мышей с дефицитом PLD1, вызванного GPIb-зависимым дефектом интегрина, модуляция активации интегрина может быть результатом активности липазы PLD (Elvers et al., 2010; Stegner et al., 2013). В соответствии с этими результатами Паунер и его коллеги уже обнаружили в 2007 году, что стабильная адгезия и миграция нейтрофилов требует PLD-опосредованной активации интегринов (Powner et al., 2007).

Stegner et al. (2013) утверждали, что фармакологическое ингибирование PLD может быть безопасной терапевтической стратегией для предотвращения артериального тромбоза. Если лечение FIPI будет вызывать тот же фенотип после ИМ, который наблюдается у мышей с дефицитом PLD1, включая усиление повреждения миокарда и снижение сердечной функции, терапевтический потенциал FIPI будет под вопросом. Однако наши данные свидетельствуют о том, что блокирование ферментативной активности PLD не имеет трансляционного потенциала у пациентов с ИМ, поскольку ингибирование ферментативной активности PLD не приводит ни к изменению сердечной функции, ни к изменению размера инфаркта, по крайней мере, у мышей.Это говорит о том, что пациенты с инфарктом миокарда не получат никакой пользы от терапии на основе FIPI в отношении улучшения сердечной функции.

Интервью: Кризис COVID-19 в Индии нанесет урон спросу на нефть, но не глубокий: глава FIPI

Особенности

Квартал с апреля по июнь может упасть с уровня первого квартала

Нефтепереработчики осторожно относятся к пробегам, импорт сырой нефти на фоне неопределенных перспектив

Platts Analytics ожидает устойчивого восстановления спроса на нефть в третьем полугодии

Сингапур - Беспрецедентный кризис COVID-19 в Индии скажется на спросе на нефть в апреле-июне, поскольку нефтепереработчики стремятся сократить объемы производства и импорт сырой нефти на фоне ослабления транспортного спроса и нарушения промышленной деятельности, заявил глава Федерации Об этом S&P Global Platts сообщили в Indian Petroleum Industry.

Не зарегистрированы?

Получайте ежедневные уведомления по электронной почте, заметки для подписчиков и персонализируйте свой опыт.

Зарегистрируйтесь сейчас

Страна, в которой ежедневно в течение почти двух недель регистрировалось более 300000 новых случаев коронавируса, стоит перед сложной задачей, и перспективы потребления нефти могут ухудшиться в следующие несколько недель, прежде чем восстановятся в следующих кварталах, сказал Р.К. Малхотра, генеральный директор ФИПИ.

«Глядя на ситуацию сейчас, на стабилизацию может уйти несколько месяцев», - сказал Малхотра. «Этот квартал будет не так хорош для нефти, поскольку региональные блокировки ограничили многие виды деятельности. И это еще не все», - сказал Малхотра в интервью Platts.

Премьер-министр Индии Нарендра Моди призвал лидеров различных штатов сосредоточить внимание на микрозонах сдерживания и использовать блокировку только в крайнем случае. Но многие провинции планируют ввести региональную изоляцию из опасений, что ситуация может ухудшиться.

«Трудно сказать, когда инфекция в стране в целом достигнет пика, хотя в некоторых городах он, возможно, уже достиг своего пика. Компании и организации сосредоточены на борьбе с пандемией. Сейчас это большой приоритет. Это нарушит промышленную деятельность в несколько карманов, - сказал Малхотра.

Набор фактов по теме: возрождение COVID-19 в Индии мешает энергетике, металлам и сельскому хозяйству

Возможно дальнейшее падение спроса

S&P Global Platts Analytics заявила, что в 2021 году в Индии будет наблюдаться рост спроса на нефть в годовом исчислении на 400 000 баррелей в день, что было пересмотрено в сторону понижения по сравнению с более ранней оценкой роста в 440 000 баррелей в день, поскольку страна борется с рекордными случаями COVID-19. .

Крис Миджли, глава глобального аналитического отдела Platts, заявил на прошлой неделе, что эти цифры, возможно, могут быть понижены еще на 20 000 баррелей в день, но любой дальнейший пересмотр будет зависеть от того, как будет развиваться ситуация в следующие несколько недель.

Но Миджли добавил, что Индия продолжит пользоваться плодами устойчивой мировой экономики по мере роста промышленной активности во всем мире. Спрос на нефть может замедлиться в ближайшем будущем, но было достаточно условий, чтобы полагать, что потребление во второй половине 2021 года начнет устойчивое восстановление.

Малхотра из

FIPI сказал, что спрос на бензин обязательно сильно пострадает в текущем квартале, поскольку жители предпочитают оставаться дома в своих усилиях по сдерживанию распространения вируса. Кроме того, промышленная деятельность также в некоторой степени пострадает, поскольку компании и организации отвлекают ресурсы и рабочую силу на борьбу с пандемией.

«Это повлияет на перевалку и импорт нефти. Переработчики будут осторожны и тщательно оценивать перспективы спроса, прежде чем планировать свою добычу.«В то время как спрос на бензин, газойль и реактивное топливо будет находиться под понижательным давлением, сжиженный нефтяной газ должен и дальше преуспевать из-за увеличения спроса на топливо для приготовления пищи», - сказал он.

Прогнозные ставки в Индии оставались стабильными до конца первого квартала. Согласно последнему опросу министерства нефти, средний пробег для всех категорий нефтеперерабатывающих заводов в Индии вырос до 99% в марте по сравнению с 97% в феврале. В марте производительность государственных НПЗ составила 106% по сравнению с 102% год назад и 107% в феврале.

Indian Oil Corp. зафиксировала в марте средний показатель загрузки всех девяти автономных нефтеперерабатывающих заводов на 100% по сравнению с 98% годом ранее и 101% в феврале. Но, по словам официальных лиц компании, в апреле IOC снизила процентные ставки до 90%.

Индийская компания Mangalore Refinery and Petrochemicals Ltd. также снизила свои эксплуатационные расходы, чтобы приспособиться к снижению розничного спроса на топливо, заявили представители компании.

Отвлечение ресурсов

«Если вы посмотрите на нефтепереработчиков, некоторые из них сосредоточены на помощи в таких вещах, как обеспечение больниц кислородом медицинского качества для борьбы с пандемией», - сказал Малхотра.«Поскольку некоторые продукты, такие как кислород, не используются в промышленности, в некоторых отраслях промышленности возникнут проблемы с поставками», - сказал Малхотра.

Традиционно Reliance не является производителем жидкого кислорода медицинского класса. Но, начиная с нуля до пандемии, Reliance теперь производит более 1000 тонн жидкого кислорода медицинского качества в день - или более 11% от общего объема производства Индии - на своем нефтеперерабатывающем заводе с нефтехимическим комплексом в Джамнагаре и на других предприятиях.

Кроме того, МОК отвел кислород высокой чистоты, используемый в его установке моноэтиленгликоля (МЭГ), для производства жидкого кислорода медицинского качества на нефтеперерабатывающем заводе и нефтехимическом комплексе в Панипате.Производительность установки также была уменьшена по более серьезной причине, сказал нефтепереработчик.

«Это сочетание факторов, которые будут удерживать низкие процентные ставки в этом квартале», - сказал Малхотра. «Нет никаких сомнений в том, что этот квартал будет плохим для нефтепродуктов, но мы должны увидеть улучшение в последующих кварталах и в целом во второй половине года».

Спрос на нефть в Индии снизился на 470 000 баррелей в день в 2020 году, когда первая волна пандемии снизила потребление нефтепродуктов в стране до самого низкого уровня почти за два десятилетия.

(PDF) Ген CG15630 (fipi) участвует в регуляции межимпульсного интервала в песне ухаживания дрозофилы

Заявление о раскрытии информации

Авторы не сообщали о потенциальном конфликте интересов.

Финансирование

Работа выполнена при финансовой поддержке РФФИ

по проекту № 16-34-00028мол_а.

ORCID

Сергей А. Федотов http://orcid.org/0000-0002-7428-120X

Юлия В.Брагина http://orcid.org/0000-0003-0432-0063

Беседина Наталья Геннадьевна http://orcid.org/0000-0003-0603-9486

Даниленкова Лариса Владимировна http://orcid.org / 0000-0001-7826-6106

Елена Александровна Камышева http://orcid.org/0000-0002-5301-2393

Николай Григорьевич Камышев http://orcid.org/0000-0002-3611-7417

Ссылки

Алениус, М., и Бом, С. (2003). Дифференциальная функция RNCAM iso-

форм в точном целевом отборе обонятельных сенсорных нейронов.

Развитие, 130, 917–927. doi: 10.1242 / dev.00317

Андерссон, Л.С., Лархаммар, М., Мемик, Ф., Вутц, Х., Швохов,

Д., Рубин, К.-Дж.,… Кулландер, К. (2012 ). Мутации в DMRT3

влияют на передвижение лошадей и функцию спинного мозга у мышей.

Природа, 488, 642–646. DOI: 10.1038 / nature11399

Bennet-Clark, H.C. (1984). Микрофон скорости частиц для песни

мелких насекомых и других акустических измерений. Журнал

Экспериментальная биология, 108, 459–463.

Benton, R., Vannice, K.S., & Vosshall, L.B. (2007). Существенная роль

, рецептора, связанного с CD36, в обнаружении феромонов у дрозофилы.

Природа, 450, 289–293. DOI: 10.1038 / nature06328

Bieschke, E.T., Wheeler, J.C., & Tower, J. (1998). Доксициклин-индуцированная экспрессия трансгена

во время развития и старения дрозофилы.

Молекулярная генетика и геномика, 258, 571–579. DOI: 10.1007 /

s004380050770

Borgius, L., Нисимару, Х., Калдейра, В., Кунугисе, Ю., Лоу, П., Рейг, Р.,

… Кин, О. (2014). Спинальные глутаматергические нейроны, определяемые передачей сигналов

EphA4, являются важными компонентами нормальных локомоторных цепей. Журнал неврологии, 34, 3841–3853. DOI: 10.1523 /

JNEUROSCI.4992-13.2014

Борисовска М., МакГинли М.Дж., Бенсен А. и Вестбрук Г.Л. (2011).

Потеря молекулы адгезии обонятельных клеток снижает синхронность активности митральных клеток

в обонятельных клубочках.Журнал физиологии,

589, 1927–1941. DOI: 10.1113 / jphysiol.2011.206276

Берджесс, А., Уэйнрайт, С.Р., Шихабуддин, Л.С., Рутисхаузер, У., Секи,

,

Т., и Обер, И. (2008). Полисиаловая кислота регулирует кластеризацию, миграцию

и дифференцировку нейронов клеток-предшественников во взрослом гиппокампе

. Нейробиология развития, 68, 1580–1590.

doi: 10.1002 / dneu.20681

Chintapalli, V.R., Wang, J., & Dow, J.А. (2007). Использование FlyAtlas для идентификации

более точных моделей болезней человека у Drosophila melanogaster. Природа

Генетика, 39, 715–720. DOI: 10.1038 / ng2049

Клоун, Э.Дж., Игучи, С., Басселл, Дж.Дж., Шеер, Э., и Рута, В. (2015).

Мультимодальные хемосенсорные цепи, контролирующие ухаживание самцов у

Drosophila.Neuron, 87, 1036–1049. DOI: 10.1016 / j.neuron.2015.07.025

Couto, A., Alenius, M., & Dickson, B.J. (2005). Молекулярная, анатомическая,

и функциональная организация обонятельной системы дрозофилы.

Current Biology, 15, 1535–1547. doi: 10.1016 / j.cub.2005.07.034

Дафф, М.О., Олсон, С., Вей, X., Гаррет, С.С., Осман, А., Болисетти, М.,

… Грейвли, Б.Р. (2015). Полногеномная идентификация нулевого рекурсивного сплайсинга

нуклеотидов у дрозофилы. Природа, 521, 376–379.

doi: 10.1038 / nature14475

Dweck, H.K.M., Ebrahim, S.A.M., Thoma, M., Mohamed, A.A.M.,

Keesey, I.W., Trona, F.,… Hansson, B.S. (2015). Феромоны medi-

, участвующие в копуляции и привлечении у дрозофилы.Proceedings of the

National Academy of Sciences of the United States, 112,

E2829 – E2835. Получено с www.pnas.org/cgi/doi/10.1073/pnas.

1504527112

Edgington, E.S. (1995). Рандомизационные тесты. Нью-Йорк: Марсель Деккер.

Эфрон, Б., и Тибширани, Р.Дж. (1993). Введение в бутстрап.

Лондон: Чепмен и Холл.

Федотов С.А., Брагина Ю.В., Беседина Н.Г., Даниленкова Л.В.,

Камышева Е.А., Панова А.А., Камышев Н.Г. (2014). Эффект

нейроспецифического нокдауна генов-кандидатов для локомоторного поведения -

для производства звука у Drosophila melanogaster.Fly, 8,

176–187. DOI: 10.4161 / 19336934.2014.983389

Fore, T.R., Ojwang, A.A., Warner, M.L., Peng, X., Bohm, R.A., Welch,

W.P.,… Zhang, B. (2011). Картирование и применение экспрессии флиппазы энхансера-

в личиночной и взрослой ЦНС дрозофилы. Журнал

визуализированных экспериментов, 52, e2649.DOI: 10.3791 / 2649

Гулдинг, М. (2009). Цепи, управляющие движением позвоночных:

Движение в новом направлении. Nature Reviews Neuroscience, 10,

507–518. DOI: 10.1038 / nrn2608

Graveley, B.R., Brooks, A.N., Carlson, J.W., Duff, M.O., Landolin, J.M.,

Yang, L.,… Celniker, S.E. (2011). Онтогенетический транскриптом

Drosophila melanogaster. Природа, 471, 473–479. DOI: 10.1038 /

nature09715

Grosjean, Y., Rytz, R., Farine, J.-P., Abuin, L., Cortot, J., Jefferis,

G.S.X.E., & Benton, R. (2011). Обонятельный рецептор пищевых запахов

способствует ухаживанию самцов у дрозофилы. Nature, 478,

236–240. DOI: 10.1038 / nature10428

Gu, H., & O’dowd, D.K. (2006). Холинергическая синаптическая передача в

взрослых клетках Drosophila Kenyon in situ. Журнал неврологии, 26,

265–272. DOI: 10.1523 / JNEUROSCI.4109-05.2006

H €

асемейер, М., Япичи, Н., Хеберлейн, У., и Диксон, Б.Дж. (2009).

Сенсорные нейроны половых путей дрозофилы регулируют репродуктивное поведение самок.

. Нейрон, 61, 511–518. DOI: 10.1016 /

j.neuron.2009.01.009

Хуанг Дж. и Чен Ф. (2006). Одновременная амплификация 50 и 30 кДНК

заканчивается на основе эффекта переключения матрицы и обратной ПЦР.

BioTechniques, 40, 187–189. DOI: 10.2144 / 000112051

Илиади, К.Г., Камышев, Н.Г., Попов А.В., Илиади Н.Н., Рашковецкая,

Е.Л., Нево Э., Король А. (2009). Особенности ухаживания

в популяциях Drosophila melanogaster адаптировали

к градиенту микроэкологических условий. Journal of Evolutionary

Биохимия и физиология, 45, 579–588. DOI: 10.1134 /

S002209300